double immunofluorescence labeling for piezo1 Search Results


99
ATCC hek293t cells
DAAM2 Partially Co-localizes with Nephrin and INF2 to Human and Rat Glomerular Podocytes (A–D) Immunofluorescence staining shows that DAAM2 localizes to podocytes in rat glomeruli and partially co-localizes with (A) nephrin, and (B) Inverted Formin 2 (INF2) but to a lesser extent with (C) synaptopodin (SYNPO) or (D) actinin-alpha-4 (ACTN4). (E) Immunohistochemistry (IHC) staining using specific custom-made anti-DAAM2 antibody (Boston molecules) shows DAAM2 to localize to healthy human kidney glomeruli, in a pattern strongly suggestive of podocyte localization. (F) GFP_DAAM2 but not GFP_Mock co-precipitates Myc_INF2 using a co-immunoprecipitation assay (Co-IP) in <t>HEK293T</t> cells.
Hek293t Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/Piezo1+knock-out+HEK293T/pmc07820625-105-5-7
Average 99 stars, based on 1 article reviews
hek293t cells - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp piezo1 hs00207230 m1
(A) Purified human peripheral blood or tonsillar naive B cells were loaded with the Ca2+ indicator dye, CAL520, and placed in a glass chamber for 5 to 30 min, in the absence (Untreated) or presence of the <t>Piezo1</t> inhibitor, GsMTx4. The cells were then touched with a glass probe and images were captured by confocal microscopy. Left: Images of the Ca2+ signals of two representative cells that were either untreated or treated with GsMTx4 before, during, and after contact with the glass probe. Middle: Quantification of the fold-increase in Ca2+ flux for each of the cells over the course of 40 s. Right: The average fold-change in Ca2+ flux (relative to that in cells at the time of first contact) in untreated B cells (36 cells) and GsMTx4-treated B cells (54 cells) over 13 s. Data are means ± SEM from three experiments. (B) Purified human tonsillar CD10− naïve and memory B cells were loaded with CAL520 and a red fluorescent dye as an indicator of cell volume and were placed on a planar lipid bilayer (PLB) or glass coverslips (Glass) and imaged over time by TIRFM. Top: Representative images of two B cells placed on PLB or glass and displayed as color-coded ratio images by normalizing CAL520 MFI with red fluorescence dye MFI and quantification of Ca2+ fluxes and contact areas with time after first contact with the PLB (26 cells) or glass (36 cells). Bottom: The fold-change in Ca2+ flux over time relative to the first point of contact of the cell with glass or PLB (left) and the area of contact of the indicated cells with the surface over time (right). Right: Comparison of the maximal Ca2+ flux increases of cells placed on PLB or glass, which were calculated for each cell by normalizing its maximal CAL520 MFI to the MFI upon first contact with PLB (33 cells) or glass (110 cells). Data are means ± SEM from one experiment that is representative of six experiments. (C) Tonsillar naïve B cells and memory B cells were left untreated or were pretreated with 20 μM OB-1 and analyzed by TIRFM on glass in the continued presence of OB-1. Left: Representative images of two cells (top) and quantification of changes in Ca2+ flux (bottom left) and cell area (bottom right) over time. Right: Comparison of the maximal Ca2+ flux increases and maximal area of cell spreading (Areamax) for cells placed on glass in the absence (27 cells) or presence (39 cells) of OB-1. Data are means ± SEM from one experiment that is representative of 11 experiments. (D) BCR− Ramos cells or Ramos cells transduced to stably express exogeneous IgM H and L chain (Trans BCR+) were loaded with CAL520 and red fluorescence dye and placed on glass for the indicated times while Ca2+ flux were recorded. Representative ratio images (left) and quantification of fold-change in Ca2+ flux for BCR− cells (31 cells) and Trans BCR+ cells (30 cells) over time. Data are means ± SEM from one experiment that is representative of three experiments. Scale bars, 5 μm. (B to D) Scale ranges of the 8-bit, color-coded image display. The kinetic data in (A) to (D) were tested for statistical significance (95% confidence interval) with the ‘compareGrowthCurves’ function (see Materials and Methods). **P ≤ 0.01, ***P ≤ 0.001, and ****P ≤ 0.0001; ns, not significant. For (B and C, right), data were analyzed by two-tailed unpaired t-test with Welch’s correction. ***P ≤ 0.001 and ****P ≤ 0.0001.
Gene Exp Piezo1 Hs00207230 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/Gene+Exp%2E+PIEZO1%2C+Hs00207230_m1/pmc10691204-513-29-32
Average 85 stars, based on 1 article reviews
gene exp piezo1 hs00207230 m1 - by Bioz Stars, 2026-09
85/100 stars
  Buy from Supplier

96
Proteintech piezo1 antibody
a Meta-analysis of published GEO data analysis showing <t>Piezo1,</t> integrin, collagen and connective tissue growth factor (CTGF) expression in lung fibrosis (bleomycin-mediated lung fibrosis, “Bleo”) and heart with sham and injury. b Correlation of Piezo1 and integrin β1 expression in the lung and heart with sham and fibrosis in GEO data. c Representative images of Masson’s trichrome-stained sections from the negative control (NC) and MI rats. Scale bar, 5 mm (LV: left ventricular). d Elastic modulus of the heart sections from NC and MI rats. The elastic modulus of the heart tissue increases from 4.35 kPa (NC) to 8.38 kPa (MI-7d) finally to 16.22 kPa (MI-28d). e Immunohistochemical staining of α-SMA, integrin β1, and Piezo1 in the cardiac tissues of NC and MI rats. Scale bar, 200 μm. f Relative protein levels of α-SMA and Piezo1 determined by Western blot analysis. g RT-PCR analysis of Col 1, α-SMA, TGF-β1, PDGFR-α, TCF21, Piezo1, and integrin β1 in NC and MI rats.
Piezo1 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/Piezo1+(extracellular+domain)+Antibody/pmc09448780-181-36-47
Average 96 stars, based on 1 article reviews
piezo1 antibody - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

98
MedChemExpress piezo1 agonist yoda1
LSS downregulates <t>Piezo1</t> and elevates reactive oxygen species (ROS) levels. dHL-60 cells were exposed to LSS or PSS for 24h. (A) Piezo1 and HDAC2 protein expression of dHL-60 cells were determined by Western blot. (B) Piezo1 and HDAC2 mRNA level of dHL-60 cells was determined by RT-qPCR, normalized to the amount of β-actin. (C) Immunofluorescent staining of the Piezo1 expression of dHL-60 cells. Scale bar, 50 μm. (D) Intracellular Ca 2+ concentration of dHL-60 cells. (E) Intracellular ROS levels of dHL-60 cells. The data are presented as the mean ± SEM. (n=3). * P < 0.05, ** P < 0.01, *** P < 0.001.
Piezo1 Agonist Yoda1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/Yoda+1/bio_rxiv__2023__02__19__529165-61-7-13
Average 98 stars, based on 1 article reviews
piezo1 agonist yoda1 - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

94
Addgene inc mouse piezo1
<t>Piezo1</t> is expressed in primary microglia (A) The relative expression of mechanically activated ion channel mRNA in primary microglia was analyzed by real-time RT-PCR using the ΔΔCT method. Bars represent mean ± SEM N = 3 independent experiments. Two-tailed unpaired t-test. ∗p < 0.05. (B) Representative traces of Yoda1-induced inward currents in primary microglia recorded at −60 mV under the indicated conditions. (C) Scatterplots of Yoda1-induced inward currents in the indicated conditions. Bars represent mean ± SEM N = 4 in the Yoda1 group, n = 5 in the GsMTx4+Yoda1 group. Two-tailed unpaired t-test. ∗p < 0.05. (D) Representative live-cell imaging of primary microglia loaded with Fura-2 at rest state (upper panel) and at the time of maximum fluorescence (lower panel). Scale bar = 20 μm (E) Representative calcium imaging traces of Fura-2 (F340/F380 ratio) in primary microglia treated with different Yoda1 and/or GsMTx4 concentrations. (F) Statistical analysis of ΔF/F0 (%) in primary microglia under different Yoda1 and/or GsMTx4 concentrations. Bars represent the mean ± SD N = 3 independent experiments; 20-30 cells analyzed per experiment. Two-tailed Mann-Whitney U test. ∗∗∗∗p < 0.0001.
Mouse Piezo1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/Piezo1(WT)+(Plasmid+%2372281)/pmc09926228-309-17-26
Average 94 stars, based on 1 article reviews
mouse piezo1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Alomone Labs anti piezo1 antibody
SNI induces <t>Piezo1</t> overexpression in ACC neurons. ( A ) SNI-induced bilateral expression of Piezo1 in the ACC. Left, Cg1 and Cg2 tissues were used for Western blotting. Coronal dissection was performed 3.0–0.5 mm anterior to the Bregma. A representative Western blot of Piezo1 expression in the bilateral ACC is shown in the middle. The protein quantification results from Western blotting are shown on the right. Significant differences in Piezo1 expression were observed on both sides of the ACC 7 d after SNI. * p -value < 0.05, ** p -value < 0.01 versus the sham group (two-way ANOVA). ( B – D ) Representative double immunofluorescence staining showing the overlap (yellow) of Piezo1-IR (red) with neuronal marker NeuN (green), but not with microglial marker Iba1 (green) and astrocyte marker GFAP (green), 7 d after SNI. The arrowhead in ( C ) indicates Iba1-IR surrounding or partially overlapping Piezo1-IR. Scale bar = 50 μm. The fluorescence intensity curves for red and green signals in the boxed areas are shown on the right side for each group.
Anti Piezo1 Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/Anti-Piezo1+Antibody/pmc09655876-126-2-5
Average 94 stars, based on 1 article reviews
anti piezo1 antibody - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

96
Tocris selective piezo1 activator yoda1 2 5 2 6 dichlorophenyl methyl sulfanyl 1 3 4thiadiazol 2 yl pyrazine
Figure 1. Expression of <t>Piezo1</t> in eMSC spheroids. (A) Immunofluorescent staining evidenced the presence of Piezo1 proteins. Shown are representative confocal slices obtained from the bottom plane (near the cover glass) and through the center of the spheroid. The schematic illustrations of focal planes used for acquisition are shown at the right from the images. Red channel—Piezo1 immunofluorescence, blue channel—cell nuclei. Note that in the focal plane through the center no Piezo1 staining is observed in the cells inside the spheroids, which is presumably due to the inability of the antibodies to penetrate inside the spheroid mass as well as the used antibodies not requiring permeabilization. No staining was observed if the primary antibodies were omitted (Supplementary Figure S1). (B) PIEZO1 mRNA was detected in spheroid lysates: the primers against PIEZO1 amplified the product of the expected size (165 bp). Original gels are shown in Supplementary Figure S2 (C) Relative mRNA expression levels of PIEZO1 in 2D and 3D eMSC cultures counted using the 2−∆∆Ct method. The qPCR data were normalized to HPRT1 and TBP gene mRNA (see Section 3). ***—significantly different, unpaired t-test, p < 0.001.
Selective Piezo1 Activator Yoda1 2 5 2 6 Dichlorophenyl Methyl Sulfanyl 1 3 4thiadiazol 2 Yl Pyrazine, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/Yoda+1/pm40141118-253-0-7
Average 96 stars, based on 1 article reviews
selective piezo1 activator yoda1 2 5 2 6 dichlorophenyl methyl sulfanyl 1 3 4thiadiazol 2 yl pyrazine - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology human piezo1
Modulation of neurite elongation by <t>PIEZO1</t> in MagNAV-loaded hiPSC-derived RGCs. (A) Immunofluorescence staining showing PIEZO1 (red) expression in TUJ1-positive RGCs (green), with nuclei labeled by DAPI (blue), confirming localization in both soma and proximal neurites. The enlarged image in the red box shows the localization of PIEZO1 in cell bodies and neurites. Scale bar = 50μm. (B, C) CCK-8 assay results showing the cytocompatibility of Yoda1 (B) and Dooku1 (C) at increasing concentrations. Yoda1 showed cytotoxicity above 20 μM, while Dooku1 maintained acceptable viability up to 10 μM. (D) Representative brightfield images of RGCs following treatment with 10 μM Yoda1 or Dooku1, showing no obvious morphological changes. (E) Quantification of neurite length under different treatment conditions. Dooku1 significantly enhanced neurite outgrowth, whereas Yoda1 had no significant effect relative to control. Data are presented as mean ± SEM. ∗p < 0.05.
Human Piezo1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/PIEZO1+shRNA+(h)+Lentiviral+Particles/pmc12590149-101-12-15
Average 93 stars, based on 1 article reviews
human piezo1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

99
MedChemExpress piezo1
Ischemia-reperfusion injury induced an upregulation of <t>Piezo1.</t> WT male mice and Piezo1 td/Tdt male mice underwent the I/R injury (30min/4h). NMCMs were extracted from both WT and Piezo1 td/Tdt mice and subjected to 8-h hypoxia and 1-h reoxygenation. (A) Western blot analysis and quantitative data of Piezo1 expression in the infarcted and non-infarcted regions of the hearts. (B) Relative expression levels of mRNA for Piezo1 in the infarcted area or non-infarcted area. (C) Representative immunohistochemical staining images and statistical data of Piezo1 expression in the infarcted and non-infarcted regions of the hearts. Scale bar, 1 mm. Detailed photographs are displayed below. Scale bar, 100 μm. (D) Representative images of Piezo1 stained with antibodies against RFP (red). Scale bar, 30 μm. (E) Western blot analysis and quantitative data of Piezo1 expression in NMCMs in Ctrl or H/R groups. (F) Relative expression levels of mRNA for Piezo1 in NMCMs in Ctrl or H/R groups. (G) Representative images of Piezo1 in NMCMs from Piezo1 td/Tdt mice. Scale bar, 25 μm. n = 4 for Western blot analysis, n = 6 for other results. Data are presented as mean ± SEM. ∗P < 0.05.
Piezo1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/Mdivi-1/pmc11750285-51-5-13
Average 99 stars, based on 1 article reviews
piezo1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

95
Novus Biologicals antibodies against piezo1
Fig. 2 Histological analysis and the expression of <t>Piezo1</t> and type II collage in human nucleus pulposus tissues. A, B Hematoxylin and eosin (H&E) staining in human NP tissues of the control or the IVDD group (200×). C, D Piezo1 immunostaining in human NP tissues of the control or the IVDD group (100×). E The percentage of Piezo1 positive cells to all cells in the field (%). F, G Type II collage immunostaining in human NP tissues of the control or the IVDD group (100×). H The percentage of Col II positive cells to all cells in the field (%). *p < 0.05
Antibodies Against Piezo1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/PIEZO1+Antibody+(2-10)/pm35606793-73-7-10
Average 95 stars, based on 1 article reviews
antibodies against piezo1 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

93
Novus Biologicals piezo1
A Immunofluorescence images of <t>Piezo1</t> (magenta) and Piezo2 (green) in the femurs of WT mice. Scale bar: 20 µm. The right panels show optical sections from Airyscan superresolution images merged with differential interference contrast (DIC) images in the area indicated by white rectangles. Mature osteoblasts (Ob), osteocytes (Ocy) and osteoclasts (Oc) expressing Piezo1 and Piezo2. Scale bar: 5 µm. B , D Piezo1 (magenta) and Piezo2 (green) immunofluorescence images of trabecular (upper) and cortical (lower) bones in the distal femur from each group. Scale bars: 50 µm. C Piezo1 fluorescence intensity and number of Piezo1-positive surfaces per trabecular bone surface (Piezo1 + . S/BS) were significantly lower than those in the controls. E Piezo2 fluorescence intensity and number of Piezo2-positive surfaces per trabecular bone surface (Piezo2 + S/BS) were significantly lower than those in the controls. F Immunoblot analyses of Piezo1 and Piezo2 expression in the femur. Graphs showing the results of the quantitative analysis of the band intensities. n = 3–4 male mice per group. The data are presented as the median with IQR. One-way ANOVA with Tukey’s post hoc test was used. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control groups.
Piezo1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/double+immunofluorescence+labeling+for+piezo1/PIEZO1+Antibody+%5BHRP%5D/pmc12397299-294-39-42
Average 93 stars, based on 1 article reviews
piezo1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


DAAM2 Partially Co-localizes with Nephrin and INF2 to Human and Rat Glomerular Podocytes (A–D) Immunofluorescence staining shows that DAAM2 localizes to podocytes in rat glomeruli and partially co-localizes with (A) nephrin, and (B) Inverted Formin 2 (INF2) but to a lesser extent with (C) synaptopodin (SYNPO) or (D) actinin-alpha-4 (ACTN4). (E) Immunohistochemistry (IHC) staining using specific custom-made anti-DAAM2 antibody (Boston molecules) shows DAAM2 to localize to healthy human kidney glomeruli, in a pattern strongly suggestive of podocyte localization. (F) GFP_DAAM2 but not GFP_Mock co-precipitates Myc_INF2 using a co-immunoprecipitation assay (Co-IP) in HEK293T cells.

Journal: American Journal of Human Genetics

Article Title: DAAM2 Variants Cause Nephrotic Syndrome via Actin Dysregulation

doi: 10.1016/j.ajhg.2020.11.008

Figure Lengend Snippet: DAAM2 Partially Co-localizes with Nephrin and INF2 to Human and Rat Glomerular Podocytes (A–D) Immunofluorescence staining shows that DAAM2 localizes to podocytes in rat glomeruli and partially co-localizes with (A) nephrin, and (B) Inverted Formin 2 (INF2) but to a lesser extent with (C) synaptopodin (SYNPO) or (D) actinin-alpha-4 (ACTN4). (E) Immunohistochemistry (IHC) staining using specific custom-made anti-DAAM2 antibody (Boston molecules) shows DAAM2 to localize to healthy human kidney glomeruli, in a pattern strongly suggestive of podocyte localization. (F) GFP_DAAM2 but not GFP_Mock co-precipitates Myc_INF2 using a co-immunoprecipitation assay (Co-IP) in HEK293T cells.

Article Snippet: Overexpression experiments were performed in HEK293T cells (ATCC biological resource center) and in immortalized human podocytes that were a gift from Dr. Moin Saleem (University of Bristol, Bristol, UK).

Techniques: Immunofluorescence, Staining, Immunohistochemistry, Co-Immunoprecipitation Assay

(A) Purified human peripheral blood or tonsillar naive B cells were loaded with the Ca2+ indicator dye, CAL520, and placed in a glass chamber for 5 to 30 min, in the absence (Untreated) or presence of the Piezo1 inhibitor, GsMTx4. The cells were then touched with a glass probe and images were captured by confocal microscopy. Left: Images of the Ca2+ signals of two representative cells that were either untreated or treated with GsMTx4 before, during, and after contact with the glass probe. Middle: Quantification of the fold-increase in Ca2+ flux for each of the cells over the course of 40 s. Right: The average fold-change in Ca2+ flux (relative to that in cells at the time of first contact) in untreated B cells (36 cells) and GsMTx4-treated B cells (54 cells) over 13 s. Data are means ± SEM from three experiments. (B) Purified human tonsillar CD10− naïve and memory B cells were loaded with CAL520 and a red fluorescent dye as an indicator of cell volume and were placed on a planar lipid bilayer (PLB) or glass coverslips (Glass) and imaged over time by TIRFM. Top: Representative images of two B cells placed on PLB or glass and displayed as color-coded ratio images by normalizing CAL520 MFI with red fluorescence dye MFI and quantification of Ca2+ fluxes and contact areas with time after first contact with the PLB (26 cells) or glass (36 cells). Bottom: The fold-change in Ca2+ flux over time relative to the first point of contact of the cell with glass or PLB (left) and the area of contact of the indicated cells with the surface over time (right). Right: Comparison of the maximal Ca2+ flux increases of cells placed on PLB or glass, which were calculated for each cell by normalizing its maximal CAL520 MFI to the MFI upon first contact with PLB (33 cells) or glass (110 cells). Data are means ± SEM from one experiment that is representative of six experiments. (C) Tonsillar naïve B cells and memory B cells were left untreated or were pretreated with 20 μM OB-1 and analyzed by TIRFM on glass in the continued presence of OB-1. Left: Representative images of two cells (top) and quantification of changes in Ca2+ flux (bottom left) and cell area (bottom right) over time. Right: Comparison of the maximal Ca2+ flux increases and maximal area of cell spreading (Areamax) for cells placed on glass in the absence (27 cells) or presence (39 cells) of OB-1. Data are means ± SEM from one experiment that is representative of 11 experiments. (D) BCR− Ramos cells or Ramos cells transduced to stably express exogeneous IgM H and L chain (Trans BCR+) were loaded with CAL520 and red fluorescence dye and placed on glass for the indicated times while Ca2+ flux were recorded. Representative ratio images (left) and quantification of fold-change in Ca2+ flux for BCR− cells (31 cells) and Trans BCR+ cells (30 cells) over time. Data are means ± SEM from one experiment that is representative of three experiments. Scale bars, 5 μm. (B to D) Scale ranges of the 8-bit, color-coded image display. The kinetic data in (A) to (D) were tested for statistical significance (95% confidence interval) with the ‘compareGrowthCurves’ function (see Materials and Methods). **P ≤ 0.01, ***P ≤ 0.001, and ****P ≤ 0.0001; ns, not significant. For (B and C, right), data were analyzed by two-tailed unpaired t-test with Welch’s correction. ***P ≤ 0.001 and ****P ≤ 0.0001.

Journal: Science signaling

Article Title: B cell responses to membrane-presented antigens require the function of the mechanosensitive cation channel Piezo1

doi: 10.1126/scisignal.abq5096

Figure Lengend Snippet: (A) Purified human peripheral blood or tonsillar naive B cells were loaded with the Ca2+ indicator dye, CAL520, and placed in a glass chamber for 5 to 30 min, in the absence (Untreated) or presence of the Piezo1 inhibitor, GsMTx4. The cells were then touched with a glass probe and images were captured by confocal microscopy. Left: Images of the Ca2+ signals of two representative cells that were either untreated or treated with GsMTx4 before, during, and after contact with the glass probe. Middle: Quantification of the fold-increase in Ca2+ flux for each of the cells over the course of 40 s. Right: The average fold-change in Ca2+ flux (relative to that in cells at the time of first contact) in untreated B cells (36 cells) and GsMTx4-treated B cells (54 cells) over 13 s. Data are means ± SEM from three experiments. (B) Purified human tonsillar CD10− naïve and memory B cells were loaded with CAL520 and a red fluorescent dye as an indicator of cell volume and were placed on a planar lipid bilayer (PLB) or glass coverslips (Glass) and imaged over time by TIRFM. Top: Representative images of two B cells placed on PLB or glass and displayed as color-coded ratio images by normalizing CAL520 MFI with red fluorescence dye MFI and quantification of Ca2+ fluxes and contact areas with time after first contact with the PLB (26 cells) or glass (36 cells). Bottom: The fold-change in Ca2+ flux over time relative to the first point of contact of the cell with glass or PLB (left) and the area of contact of the indicated cells with the surface over time (right). Right: Comparison of the maximal Ca2+ flux increases of cells placed on PLB or glass, which were calculated for each cell by normalizing its maximal CAL520 MFI to the MFI upon first contact with PLB (33 cells) or glass (110 cells). Data are means ± SEM from one experiment that is representative of six experiments. (C) Tonsillar naïve B cells and memory B cells were left untreated or were pretreated with 20 μM OB-1 and analyzed by TIRFM on glass in the continued presence of OB-1. Left: Representative images of two cells (top) and quantification of changes in Ca2+ flux (bottom left) and cell area (bottom right) over time. Right: Comparison of the maximal Ca2+ flux increases and maximal area of cell spreading (Areamax) for cells placed on glass in the absence (27 cells) or presence (39 cells) of OB-1. Data are means ± SEM from one experiment that is representative of 11 experiments. (D) BCR− Ramos cells or Ramos cells transduced to stably express exogeneous IgM H and L chain (Trans BCR+) were loaded with CAL520 and red fluorescence dye and placed on glass for the indicated times while Ca2+ flux were recorded. Representative ratio images (left) and quantification of fold-change in Ca2+ flux for BCR− cells (31 cells) and Trans BCR+ cells (30 cells) over time. Data are means ± SEM from one experiment that is representative of three experiments. Scale bars, 5 μm. (B to D) Scale ranges of the 8-bit, color-coded image display. The kinetic data in (A) to (D) were tested for statistical significance (95% confidence interval) with the ‘compareGrowthCurves’ function (see Materials and Methods). **P ≤ 0.01, ***P ≤ 0.001, and ****P ≤ 0.0001; ns, not significant. For (B and C, right), data were analyzed by two-tailed unpaired t-test with Welch’s correction. ***P ≤ 0.001 and ****P ≤ 0.0001.

Article Snippet: Reverse transcription and qRT-PCR qRT-PCR assays were performed with a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems), Cells-to-CT 1-Step Taqman Kit (Invitrogen, A25603), and GAPDH (NM_002046.3) and PIEZO1 (Hs00207230_m1) TaqMan Probes (Thermo Fisher).

Techniques: Purification, Confocal Microscopy, Fluorescence, Comparison, Stable Transfection, Two Tailed Test

(A) Purified human tonsillar B cells were labeled with CAL520 and a monoclonal antibody specific for the GC B cell marker, CD10, to gate naïve and memory B cells. After 180 s of baseline recording (None, black), 15 μM Yoda1 (blue) was added to the B cells in solution, which was followed by the addition of 2 mM EGTA (red). Ca2+ signals were analyzed for 1200 s by flow cytometry. Left: Representative plot of the median CAL520 fluorescence intensity (FI) values over time. Right: Quantification of the Ca2+ influxes calculated for B cells from five donors as the fold-change in the median CAL520 FI induced by Yoda-1 relative to the baseline FI. Data are means ± SEM from five independent experiments. (B) B cells purified from human PBMCs with magnetic beads were transfected with either control siRNA (Control) or Piezo1-specific siRNA (Piezo1-KD) with a 4D Amaxa nucleofector. Left: PIEZO1 mRNA abundance was quantified by real-time qRT-PCR analysis and normalized to that of GAPDH mRNA. Middle: Representative histogram of total Piezo1 abundance by flow cytometry after immunofluorescence staining with an Alexa Fluor 647–labeled Piezo-specific antibody. Right: Quantification of Piezo1 abundance for B cells from four donors shown as the ratio of the Piezo1 abundance in Piezo1-KD cells relative to that in Control cells. Data are means ± SEM from four independent experiments. (C) Control and Piezo1-KD B cells were labeled with CAL520 and Ca2+ flux was measured over time by flow cytometry before and after the addition of 15 μM Yoda-1. Left: Representative Ca2+ curves after Yoda-1 treatment of the indicate cells. Right: Quantification of the percentage inhibition of the Ca2+ flux in Piezo1-KD cells as compared to that in Control cells obtained from six donors. Data are means ± SEM from six independent experiments. (D) Control and Piezo1-KD B cells were labeled with CAL520, and Ca2+ fluxes were measured over time by flow cytometry for cells treated with Yoda-1, anti-Ig, or ionomycin. Left: Representative Ca2+ kinetics plot with arrows marking the times, after baseline recording, when each stimulant was added. Right: Quantification of Ca2+ increases induced by Yoda1, soluble anti-Ig, or ionomycin were calculated as the ratio of the fold-changes in CAL520 MFI between Piezo1-KD and Control cells upon stimulation relative to the baseline MFI for B cells from nine donors. Data are means ± SEM from nine independent experiments. (E) Control and Piezo1-KD B cells were labeled with Flipper-TR and placed on glass and the lifetime decay of the dye was determined. Left: Two representative B cells showing lifetime decay. Right: Quantification of the lifetime decay of Flipper-TR for control (111 cells) and Piezo1-KD (177 cells) B cells. Scale bars, 5 μm. Data are means ± SEM from five independent experiments. *P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001; ns, not significant. Data in (A) to (C) were analyzed by one-sample t test with a hypothetical value of zero, data in (D) were analyzed by Kruskal-Wallis test, followed by Dunn’s multiple comparisons test; and data in (E) were analyzed by two-tailed, unpaired t test with Welch’s correction.

Journal: Science signaling

Article Title: B cell responses to membrane-presented antigens require the function of the mechanosensitive cation channel Piezo1

doi: 10.1126/scisignal.abq5096

Figure Lengend Snippet: (A) Purified human tonsillar B cells were labeled with CAL520 and a monoclonal antibody specific for the GC B cell marker, CD10, to gate naïve and memory B cells. After 180 s of baseline recording (None, black), 15 μM Yoda1 (blue) was added to the B cells in solution, which was followed by the addition of 2 mM EGTA (red). Ca2+ signals were analyzed for 1200 s by flow cytometry. Left: Representative plot of the median CAL520 fluorescence intensity (FI) values over time. Right: Quantification of the Ca2+ influxes calculated for B cells from five donors as the fold-change in the median CAL520 FI induced by Yoda-1 relative to the baseline FI. Data are means ± SEM from five independent experiments. (B) B cells purified from human PBMCs with magnetic beads were transfected with either control siRNA (Control) or Piezo1-specific siRNA (Piezo1-KD) with a 4D Amaxa nucleofector. Left: PIEZO1 mRNA abundance was quantified by real-time qRT-PCR analysis and normalized to that of GAPDH mRNA. Middle: Representative histogram of total Piezo1 abundance by flow cytometry after immunofluorescence staining with an Alexa Fluor 647–labeled Piezo-specific antibody. Right: Quantification of Piezo1 abundance for B cells from four donors shown as the ratio of the Piezo1 abundance in Piezo1-KD cells relative to that in Control cells. Data are means ± SEM from four independent experiments. (C) Control and Piezo1-KD B cells were labeled with CAL520 and Ca2+ flux was measured over time by flow cytometry before and after the addition of 15 μM Yoda-1. Left: Representative Ca2+ curves after Yoda-1 treatment of the indicate cells. Right: Quantification of the percentage inhibition of the Ca2+ flux in Piezo1-KD cells as compared to that in Control cells obtained from six donors. Data are means ± SEM from six independent experiments. (D) Control and Piezo1-KD B cells were labeled with CAL520, and Ca2+ fluxes were measured over time by flow cytometry for cells treated with Yoda-1, anti-Ig, or ionomycin. Left: Representative Ca2+ kinetics plot with arrows marking the times, after baseline recording, when each stimulant was added. Right: Quantification of Ca2+ increases induced by Yoda1, soluble anti-Ig, or ionomycin were calculated as the ratio of the fold-changes in CAL520 MFI between Piezo1-KD and Control cells upon stimulation relative to the baseline MFI for B cells from nine donors. Data are means ± SEM from nine independent experiments. (E) Control and Piezo1-KD B cells were labeled with Flipper-TR and placed on glass and the lifetime decay of the dye was determined. Left: Two representative B cells showing lifetime decay. Right: Quantification of the lifetime decay of Flipper-TR for control (111 cells) and Piezo1-KD (177 cells) B cells. Scale bars, 5 μm. Data are means ± SEM from five independent experiments. *P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001; ns, not significant. Data in (A) to (C) were analyzed by one-sample t test with a hypothetical value of zero, data in (D) were analyzed by Kruskal-Wallis test, followed by Dunn’s multiple comparisons test; and data in (E) were analyzed by two-tailed, unpaired t test with Welch’s correction.

Article Snippet: Reverse transcription and qRT-PCR qRT-PCR assays were performed with a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems), Cells-to-CT 1-Step Taqman Kit (Invitrogen, A25603), and GAPDH (NM_002046.3) and PIEZO1 (Hs00207230_m1) TaqMan Probes (Thermo Fisher).

Techniques: Purification, Labeling, Marker, Flow Cytometry, Fluorescence, Magnetic Beads, Transfection, Control, Quantitative RT-PCR, Immunofluorescence, Staining, Inhibition, Two Tailed Test

(A) Control and Piezo1-KD B cells were loaded with CAL520 and a red fluorescent dye, placed on PLB or PLB–anti-Ig, and Ca2+ fluxes were imaged at 37°C by TIRFM. Top: Representative images of color-coded Ca2+ signals normalized by cell volume for one representative cell for each condition. Bottom: Quantification of the dynamics of the Ca2+ fluxes (left) and contact areas (right) for Control B cells (13 cells) and Piezo1-KD cells (16 cells) placed on PLB and Control cells (26 cells) and Piezo1-KD cells (18 cells) placed on PLB-anti-Ig. Scale bars, 5 μm. Scale ranges are provided. Data are means ± SEM from five independent experiments. *P ≤ 0.05 and ****P ≤ 0.0001 as assessed by the ‘compareGrowthCurves’ function test. (B) Maximal Ca2+ increase (top) and maximal area (Areamax, bottom) were determined by calculating the fold-differences in the Ca2+ signal at the point of first contact with the PLB and at the point of maximal Ca2+ signal and contact area achieved during a 5-min incubation. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, and ****P ≤ 0.0001; ns, P > 0.05. Data were analyzed by two-tailed, unpaired t test with Welch’s correction between Control and Piezo1-KD cells and by two-tailed, paired t test between PLB and PLB-anti-Ig. Data are representative of four independent experiments. (C) BCR and F-actin recruitment to the contact area imaged by TIRFM. Control and Piezo1-KD cells labeled with Alexa Fluor 488–conjugated Fab goat anti-human IgM and IgG HC were placed on either PLB or PLB-anti-Ig for the indicted times. Fixed cells were stained with Phalloidin–Alexa Fluor 647 and imaged by TIRFM. Top: Representative images of BCR and F-actin recruited to the contact area at the indicated times for Control and Piezo1-KD cells. Bottom: Quantification of BCR (left) and F-actin (right) recruitment to the contact areas from the images for >70 cells per condition from three independent experiments. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, and ****P ≤ 0.0001 by Kruskal-Wallis test followed by Dunn’s multiple comparison tests between PLB and PLB-anti-Ig at the indicated times, as well as between Control and Piezo1-KD cells; ns, P > 0.05. (D) Control and Piezo1-KD cells were cultured for 24 hours, labeled with the cell proliferation dye, eF450, and then cultured for 5 days in chambers with PLB or PLB–anti-Ig in the absence or presence of TH medium containing anti-CD40 antibodies, IL-21, and IL-4. Left: Representative histogram of proliferation dye for each stimulation condition in Control and Piezo1-KD cells. Right: Quantification of the percentage of proliferating cells (symbol and line graph with matched donor) and the ratio of the percentage proliferation in the Piezo1-KD cells relative to that in Control cells in the same donor. Data are means ± SEM from four donors in three independent experiments. *P ≤ 0.05 as tested by one-sample t test with a theoretical mean of zero.

Journal: Science signaling

Article Title: B cell responses to membrane-presented antigens require the function of the mechanosensitive cation channel Piezo1

doi: 10.1126/scisignal.abq5096

Figure Lengend Snippet: (A) Control and Piezo1-KD B cells were loaded with CAL520 and a red fluorescent dye, placed on PLB or PLB–anti-Ig, and Ca2+ fluxes were imaged at 37°C by TIRFM. Top: Representative images of color-coded Ca2+ signals normalized by cell volume for one representative cell for each condition. Bottom: Quantification of the dynamics of the Ca2+ fluxes (left) and contact areas (right) for Control B cells (13 cells) and Piezo1-KD cells (16 cells) placed on PLB and Control cells (26 cells) and Piezo1-KD cells (18 cells) placed on PLB-anti-Ig. Scale bars, 5 μm. Scale ranges are provided. Data are means ± SEM from five independent experiments. *P ≤ 0.05 and ****P ≤ 0.0001 as assessed by the ‘compareGrowthCurves’ function test. (B) Maximal Ca2+ increase (top) and maximal area (Areamax, bottom) were determined by calculating the fold-differences in the Ca2+ signal at the point of first contact with the PLB and at the point of maximal Ca2+ signal and contact area achieved during a 5-min incubation. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, and ****P ≤ 0.0001; ns, P > 0.05. Data were analyzed by two-tailed, unpaired t test with Welch’s correction between Control and Piezo1-KD cells and by two-tailed, paired t test between PLB and PLB-anti-Ig. Data are representative of four independent experiments. (C) BCR and F-actin recruitment to the contact area imaged by TIRFM. Control and Piezo1-KD cells labeled with Alexa Fluor 488–conjugated Fab goat anti-human IgM and IgG HC were placed on either PLB or PLB-anti-Ig for the indicted times. Fixed cells were stained with Phalloidin–Alexa Fluor 647 and imaged by TIRFM. Top: Representative images of BCR and F-actin recruited to the contact area at the indicated times for Control and Piezo1-KD cells. Bottom: Quantification of BCR (left) and F-actin (right) recruitment to the contact areas from the images for >70 cells per condition from three independent experiments. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, and ****P ≤ 0.0001 by Kruskal-Wallis test followed by Dunn’s multiple comparison tests between PLB and PLB-anti-Ig at the indicated times, as well as between Control and Piezo1-KD cells; ns, P > 0.05. (D) Control and Piezo1-KD cells were cultured for 24 hours, labeled with the cell proliferation dye, eF450, and then cultured for 5 days in chambers with PLB or PLB–anti-Ig in the absence or presence of TH medium containing anti-CD40 antibodies, IL-21, and IL-4. Left: Representative histogram of proliferation dye for each stimulation condition in Control and Piezo1-KD cells. Right: Quantification of the percentage of proliferating cells (symbol and line graph with matched donor) and the ratio of the percentage proliferation in the Piezo1-KD cells relative to that in Control cells in the same donor. Data are means ± SEM from four donors in three independent experiments. *P ≤ 0.05 as tested by one-sample t test with a theoretical mean of zero.

Article Snippet: Reverse transcription and qRT-PCR qRT-PCR assays were performed with a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems), Cells-to-CT 1-Step Taqman Kit (Invitrogen, A25603), and GAPDH (NM_002046.3) and PIEZO1 (Hs00207230_m1) TaqMan Probes (Thermo Fisher).

Techniques: Control, Incubation, Two Tailed Test, Labeling, Staining, Comparison, Cell Culture

a Meta-analysis of published GEO data analysis showing Piezo1, integrin, collagen and connective tissue growth factor (CTGF) expression in lung fibrosis (bleomycin-mediated lung fibrosis, “Bleo”) and heart with sham and injury. b Correlation of Piezo1 and integrin β1 expression in the lung and heart with sham and fibrosis in GEO data. c Representative images of Masson’s trichrome-stained sections from the negative control (NC) and MI rats. Scale bar, 5 mm (LV: left ventricular). d Elastic modulus of the heart sections from NC and MI rats. The elastic modulus of the heart tissue increases from 4.35 kPa (NC) to 8.38 kPa (MI-7d) finally to 16.22 kPa (MI-28d). e Immunohistochemical staining of α-SMA, integrin β1, and Piezo1 in the cardiac tissues of NC and MI rats. Scale bar, 200 μm. f Relative protein levels of α-SMA and Piezo1 determined by Western blot analysis. g RT-PCR analysis of Col 1, α-SMA, TGF-β1, PDGFR-α, TCF21, Piezo1, and integrin β1 in NC and MI rats.

Journal: Cell Discovery

Article Title: A positive mechanobiological feedback loop controls bistable switching of cardiac fibroblast phenotype

doi: 10.1038/s41421-022-00427-w

Figure Lengend Snippet: a Meta-analysis of published GEO data analysis showing Piezo1, integrin, collagen and connective tissue growth factor (CTGF) expression in lung fibrosis (bleomycin-mediated lung fibrosis, “Bleo”) and heart with sham and injury. b Correlation of Piezo1 and integrin β1 expression in the lung and heart with sham and fibrosis in GEO data. c Representative images of Masson’s trichrome-stained sections from the negative control (NC) and MI rats. Scale bar, 5 mm (LV: left ventricular). d Elastic modulus of the heart sections from NC and MI rats. The elastic modulus of the heart tissue increases from 4.35 kPa (NC) to 8.38 kPa (MI-7d) finally to 16.22 kPa (MI-28d). e Immunohistochemical staining of α-SMA, integrin β1, and Piezo1 in the cardiac tissues of NC and MI rats. Scale bar, 200 μm. f Relative protein levels of α-SMA and Piezo1 determined by Western blot analysis. g RT-PCR analysis of Col 1, α-SMA, TGF-β1, PDGFR-α, TCF21, Piezo1, and integrin β1 in NC and MI rats.

Article Snippet: After a series of treatments, the samples were blocked with 5% bovine albumin (BSA; MP Biomedicals, USA) for 2 h and washed 3 times with PBS, and then added primary antibodies at 4 °C overnight, containing Piezo1 antibody (1:200; Affinity, DF12083, China), integrin β1 polyclonal antibody (1:1000; Proteintech, 12594-1-AP, China) and α-SMA antibody (1:1000; Cell Signaling Technology, 19245, USA).

Techniques: Expressing, Staining, Negative Control, Immunohistochemical staining, Western Blot, Reverse Transcription Polymerase Chain Reaction

a Schematic of different stages of cardiac fibrosis. In injured regions, accumulation of ECM proteins promotes tissue stiffening. b Moduli of peptide-modified PEG-MAL hydrogels with increasing concentration of PEG-SH. PEG-SH was swollen into the network (2.5% of PEG-MAL) at 1%, 1.125%, 1.25%, 1.5%, and 1.625%, resulting in hydrogels with stiffness of 4, 6, 8, 9, and 15 kPa, respectively. Elastic modulus was measured by rotational rheometry. c Immunofluorescence analysis indicated enhanced activation of CFs with increasing matrix stiffness (gray, Piezo1; green, α-SMA; Pink, Integrin β1). Scale bar, 50 μm. d RT-PCR analysis of α-SMA, PDGFR-α, TGF-β1 and Col 1 in CFs after 7-day culture. e Quantifications of integrin β1 plaque size on matrices of different elastic modulus ( n ≥ 90 data points). f Immunofluorescence and RT-PCR analyses of α-SMA, Col 1 and PDGFR-α indicated that activation of CFs decreased following siRNA silencing of Piezo1 (green, α-SMA). Scale bar, 50 μm. g Immunofluorescence and RT-PCR analyses of α-SMA, Col 1 and PDGFR-α indicated that activation of CFs decreased in integrin β1-depleted CFs, both with and without integrin-blocking antibodies (green, α-SMA). Scale bar, 50 μm.

Journal: Cell Discovery

Article Title: A positive mechanobiological feedback loop controls bistable switching of cardiac fibroblast phenotype

doi: 10.1038/s41421-022-00427-w

Figure Lengend Snippet: a Schematic of different stages of cardiac fibrosis. In injured regions, accumulation of ECM proteins promotes tissue stiffening. b Moduli of peptide-modified PEG-MAL hydrogels with increasing concentration of PEG-SH. PEG-SH was swollen into the network (2.5% of PEG-MAL) at 1%, 1.125%, 1.25%, 1.5%, and 1.625%, resulting in hydrogels with stiffness of 4, 6, 8, 9, and 15 kPa, respectively. Elastic modulus was measured by rotational rheometry. c Immunofluorescence analysis indicated enhanced activation of CFs with increasing matrix stiffness (gray, Piezo1; green, α-SMA; Pink, Integrin β1). Scale bar, 50 μm. d RT-PCR analysis of α-SMA, PDGFR-α, TGF-β1 and Col 1 in CFs after 7-day culture. e Quantifications of integrin β1 plaque size on matrices of different elastic modulus ( n ≥ 90 data points). f Immunofluorescence and RT-PCR analyses of α-SMA, Col 1 and PDGFR-α indicated that activation of CFs decreased following siRNA silencing of Piezo1 (green, α-SMA). Scale bar, 50 μm. g Immunofluorescence and RT-PCR analyses of α-SMA, Col 1 and PDGFR-α indicated that activation of CFs decreased in integrin β1-depleted CFs, both with and without integrin-blocking antibodies (green, α-SMA). Scale bar, 50 μm.

Article Snippet: After a series of treatments, the samples were blocked with 5% bovine albumin (BSA; MP Biomedicals, USA) for 2 h and washed 3 times with PBS, and then added primary antibodies at 4 °C overnight, containing Piezo1 antibody (1:200; Affinity, DF12083, China), integrin β1 polyclonal antibody (1:1000; Proteintech, 12594-1-AP, China) and α-SMA antibody (1:1000; Cell Signaling Technology, 19245, USA).

Techniques: Modification, Concentration Assay, Immunofluorescence, Activation Assay, Reverse Transcription Polymerase Chain Reaction, Blocking Assay

a Immunofluorescence analysis indicated that, in CFs cultured on stiff matrices, but not in CFs cultured on “medium” or “soft” matrices, Piezo1 expression increased with increasing RGD concentration on the matrix (grey, Piezo1). Scale bar, 50 μm. b Quantification of the immunofluorescence staining in panel a ( n ≥ 17 cells). c Blocking of integrin β1 by antibodies eliminated these effects in CFs cultured on stiff matrices, reducing both expression of Piezo1 (grey, Piezo1) and cytosolic Ca 2+ concentrations (Fluo-4 AM). Scale bar, 50 μm. d Knockdown of Piezo1 with siPiezo1 reduced expression of integrin β1 (green) and the focal adhesion proteins vinculin and paxillin (red). Scale bar, 10 μm. e , f Quantification of the fluorescence intensities in panel c ( e n ≥ 11 cells; f n ≥ 50 cells). g , h Quantifications of the data in panel d ( n ≥ 17 data points). i Overexpression of Piezo1 with Yoda1 increased expression of integrin β1 on stiff hydrogels but not soft matrix. Scale bar, 10 μm. j Quantifications of the data in panel i ( n ≥ 75 data points). k Schematic diagram of the PFL.

Journal: Cell Discovery

Article Title: A positive mechanobiological feedback loop controls bistable switching of cardiac fibroblast phenotype

doi: 10.1038/s41421-022-00427-w

Figure Lengend Snippet: a Immunofluorescence analysis indicated that, in CFs cultured on stiff matrices, but not in CFs cultured on “medium” or “soft” matrices, Piezo1 expression increased with increasing RGD concentration on the matrix (grey, Piezo1). Scale bar, 50 μm. b Quantification of the immunofluorescence staining in panel a ( n ≥ 17 cells). c Blocking of integrin β1 by antibodies eliminated these effects in CFs cultured on stiff matrices, reducing both expression of Piezo1 (grey, Piezo1) and cytosolic Ca 2+ concentrations (Fluo-4 AM). Scale bar, 50 μm. d Knockdown of Piezo1 with siPiezo1 reduced expression of integrin β1 (green) and the focal adhesion proteins vinculin and paxillin (red). Scale bar, 10 μm. e , f Quantification of the fluorescence intensities in panel c ( e n ≥ 11 cells; f n ≥ 50 cells). g , h Quantifications of the data in panel d ( n ≥ 17 data points). i Overexpression of Piezo1 with Yoda1 increased expression of integrin β1 on stiff hydrogels but not soft matrix. Scale bar, 10 μm. j Quantifications of the data in panel i ( n ≥ 75 data points). k Schematic diagram of the PFL.

Article Snippet: After a series of treatments, the samples were blocked with 5% bovine albumin (BSA; MP Biomedicals, USA) for 2 h and washed 3 times with PBS, and then added primary antibodies at 4 °C overnight, containing Piezo1 antibody (1:200; Affinity, DF12083, China), integrin β1 polyclonal antibody (1:1000; Proteintech, 12594-1-AP, China) and α-SMA antibody (1:1000; Cell Signaling Technology, 19245, USA).

Techniques: Immunofluorescence, Cell Culture, Expressing, Concentration Assay, Staining, Blocking Assay, Knockdown, Fluorescence, Over Expression

a Ca 2+ (Fluo-4 AM) imaging of CFs transfected with siRNA targeting Piezo1 (siPiezo1) or with negative control siRNA (siNT), showing reduction of mechanosensitive cytosolic Ca 2+ elevation after 3 days of culture in CFs with Piezo1 knocked down. Scale bar, 50 μm. b Quantification of fluorescence intensity data from panel a ( n ≥ 33 cells). c Immunofluorescence analysis indicated that nuclear YAP decreased following siPiezo1 inhibition of Piezo1 (blue, nucleus (DAPI); green, YAP; red, F-actin). Scale bar, 10 μm. d Quantification of the YAP nuclear-to-cytoplasmic ratio from images represented by those in panel c ( n ≥ 12 cells). e RT-PCR analysis of downstream YAP genetic targets ( CYR61 and CTGF ) in CFs with or without Piezo1 knockdown by siPiezo1. f Immunofluorescence analysis revealed that α-SMA (green), a marker of CF differentiation, was attenuated by the Piezo1 blocker GsMTx4, but that mechanosensitive α-SMA expression could be rescued by transfecting CFs to produce excess YAP. Scale bar, 50 μm. g RT-PCR analysis of α-SMA, Col 1, PDGFR-α and TGF-β1 in YAP-overexpressing CFs in the presence of GsMTx4 indicates that CF activation in response to matrix stiffness is enhanced by Piezo1 and can be rescued by YAP overexpression. h Schematic diagram of signaling downstream of the PFL.

Journal: Cell Discovery

Article Title: A positive mechanobiological feedback loop controls bistable switching of cardiac fibroblast phenotype

doi: 10.1038/s41421-022-00427-w

Figure Lengend Snippet: a Ca 2+ (Fluo-4 AM) imaging of CFs transfected with siRNA targeting Piezo1 (siPiezo1) or with negative control siRNA (siNT), showing reduction of mechanosensitive cytosolic Ca 2+ elevation after 3 days of culture in CFs with Piezo1 knocked down. Scale bar, 50 μm. b Quantification of fluorescence intensity data from panel a ( n ≥ 33 cells). c Immunofluorescence analysis indicated that nuclear YAP decreased following siPiezo1 inhibition of Piezo1 (blue, nucleus (DAPI); green, YAP; red, F-actin). Scale bar, 10 μm. d Quantification of the YAP nuclear-to-cytoplasmic ratio from images represented by those in panel c ( n ≥ 12 cells). e RT-PCR analysis of downstream YAP genetic targets ( CYR61 and CTGF ) in CFs with or without Piezo1 knockdown by siPiezo1. f Immunofluorescence analysis revealed that α-SMA (green), a marker of CF differentiation, was attenuated by the Piezo1 blocker GsMTx4, but that mechanosensitive α-SMA expression could be rescued by transfecting CFs to produce excess YAP. Scale bar, 50 μm. g RT-PCR analysis of α-SMA, Col 1, PDGFR-α and TGF-β1 in YAP-overexpressing CFs in the presence of GsMTx4 indicates that CF activation in response to matrix stiffness is enhanced by Piezo1 and can be rescued by YAP overexpression. h Schematic diagram of signaling downstream of the PFL.

Article Snippet: After a series of treatments, the samples were blocked with 5% bovine albumin (BSA; MP Biomedicals, USA) for 2 h and washed 3 times with PBS, and then added primary antibodies at 4 °C overnight, containing Piezo1 antibody (1:200; Affinity, DF12083, China), integrin β1 polyclonal antibody (1:1000; Proteintech, 12594-1-AP, China) and α-SMA antibody (1:1000; Cell Signaling Technology, 19245, USA).

Techniques: Imaging, Transfection, Negative Control, Fluorescence, Immunofluorescence, Inhibition, Reverse Transcription Polymerase Chain Reaction, Knockdown, Marker, Expressing, Activation Assay, Over Expression

a Schematic diagram of the matrix stiffness-induced integrin β1-Piezo1 PFL and the mathematical description of the loop ( C I , integrin concentration; C P , Piezo1 concentration; C a , CF activation; S ( t ), Elastic modulus; F ( t ), feedback strength). b Modeling results indicated that bifurcation (bistability, that is from reversible state to irreversible state) occurred when F [ t ] increased. c Modeling results indicated that activation became irreversible following exposure to sufficiently stiff matrices for sufficiently long-time intervals. d CFs were cultured on the plate (blue) in growth media for 1–14 days before trypsinization and transfer (light green, day 0) to soft hydrogels (orange). CFs were cultured subsequently on soft hydrogels for 1 and 7 days in growth media before collection and analysis (grey, day 1 and 7). e Immunofluorescence analysis of α-SMA in CFs after 1 and 7 days on soft hydrogels with different mechanical doses (blue, nucleus; green, a-SMA; red, F-actin). Scale bar, 50 μm. f RT-PCR analysis of α-SMA, Col 1 and PDGFR-α in CFs after 1 or 7 days on soft hydrogels with various mechanical doses. g , h Immunofluorescence analysis of integrin β1 and Piezo1 in CFs after 7 days on soft hydrogels and 21 days on stiff hydrogels (green, integrin β1; grey, Piezo1; red, F-actin). Scale bar, 10 μm. i Quantifications of length of adhesions in panel g ( n ≥ 124 data points). j RT-PCR analysis of integrin β1 and Piezo1 in CFs after 7 days on soft hydrogels and 21 days on stiff hydrogels. k Our mathematical model predicted that inhibiting feedback strength can reverse activation of CFs. l Phase diagram illustrating the irreversibility of cardiac fibrosis with respect to the feedback strength and concentration of PFL inhibitors. m CF activation can be reversed, to the greatest extent, by simultaneously inhibiting the mechanical PFL and reducing matrix elastic modulus. n , o GsMTx4 (Piezo1 inhibitor) and the combination of PLX4720 and PF562271 (inhibiting integrin β1) reduced activation of fibroblasts in conditions for which phenotypic reversal was otherwise impossible (St14), as seen by Western blot and immunofluorescence analysis. Scale bar, 50 μm.

Journal: Cell Discovery

Article Title: A positive mechanobiological feedback loop controls bistable switching of cardiac fibroblast phenotype

doi: 10.1038/s41421-022-00427-w

Figure Lengend Snippet: a Schematic diagram of the matrix stiffness-induced integrin β1-Piezo1 PFL and the mathematical description of the loop ( C I , integrin concentration; C P , Piezo1 concentration; C a , CF activation; S ( t ), Elastic modulus; F ( t ), feedback strength). b Modeling results indicated that bifurcation (bistability, that is from reversible state to irreversible state) occurred when F [ t ] increased. c Modeling results indicated that activation became irreversible following exposure to sufficiently stiff matrices for sufficiently long-time intervals. d CFs were cultured on the plate (blue) in growth media for 1–14 days before trypsinization and transfer (light green, day 0) to soft hydrogels (orange). CFs were cultured subsequently on soft hydrogels for 1 and 7 days in growth media before collection and analysis (grey, day 1 and 7). e Immunofluorescence analysis of α-SMA in CFs after 1 and 7 days on soft hydrogels with different mechanical doses (blue, nucleus; green, a-SMA; red, F-actin). Scale bar, 50 μm. f RT-PCR analysis of α-SMA, Col 1 and PDGFR-α in CFs after 1 or 7 days on soft hydrogels with various mechanical doses. g , h Immunofluorescence analysis of integrin β1 and Piezo1 in CFs after 7 days on soft hydrogels and 21 days on stiff hydrogels (green, integrin β1; grey, Piezo1; red, F-actin). Scale bar, 10 μm. i Quantifications of length of adhesions in panel g ( n ≥ 124 data points). j RT-PCR analysis of integrin β1 and Piezo1 in CFs after 7 days on soft hydrogels and 21 days on stiff hydrogels. k Our mathematical model predicted that inhibiting feedback strength can reverse activation of CFs. l Phase diagram illustrating the irreversibility of cardiac fibrosis with respect to the feedback strength and concentration of PFL inhibitors. m CF activation can be reversed, to the greatest extent, by simultaneously inhibiting the mechanical PFL and reducing matrix elastic modulus. n , o GsMTx4 (Piezo1 inhibitor) and the combination of PLX4720 and PF562271 (inhibiting integrin β1) reduced activation of fibroblasts in conditions for which phenotypic reversal was otherwise impossible (St14), as seen by Western blot and immunofluorescence analysis. Scale bar, 50 μm.

Article Snippet: After a series of treatments, the samples were blocked with 5% bovine albumin (BSA; MP Biomedicals, USA) for 2 h and washed 3 times with PBS, and then added primary antibodies at 4 °C overnight, containing Piezo1 antibody (1:200; Affinity, DF12083, China), integrin β1 polyclonal antibody (1:1000; Proteintech, 12594-1-AP, China) and α-SMA antibody (1:1000; Cell Signaling Technology, 19245, USA).

Techniques: Concentration Assay, Activation Assay, Cell Culture, Immunofluorescence, Reverse Transcription Polymerase Chain Reaction, Western Blot

The integrin β1-Piezo1 PFL suggests clues for understanding fibroblast activation during the development of myocardial infarction and fibrotic disease. A bistable switch can be turned on under pathologic conditions by stiffness-mediated activation of the PFL, eventually resulting in irreversible activation of fibroblasts as the disease progresses.

Journal: Cell Discovery

Article Title: A positive mechanobiological feedback loop controls bistable switching of cardiac fibroblast phenotype

doi: 10.1038/s41421-022-00427-w

Figure Lengend Snippet: The integrin β1-Piezo1 PFL suggests clues for understanding fibroblast activation during the development of myocardial infarction and fibrotic disease. A bistable switch can be turned on under pathologic conditions by stiffness-mediated activation of the PFL, eventually resulting in irreversible activation of fibroblasts as the disease progresses.

Article Snippet: After a series of treatments, the samples were blocked with 5% bovine albumin (BSA; MP Biomedicals, USA) for 2 h and washed 3 times with PBS, and then added primary antibodies at 4 °C overnight, containing Piezo1 antibody (1:200; Affinity, DF12083, China), integrin β1 polyclonal antibody (1:1000; Proteintech, 12594-1-AP, China) and α-SMA antibody (1:1000; Cell Signaling Technology, 19245, USA).

Techniques: Activation Assay

LSS downregulates Piezo1 and elevates reactive oxygen species (ROS) levels. dHL-60 cells were exposed to LSS or PSS for 24h. (A) Piezo1 and HDAC2 protein expression of dHL-60 cells were determined by Western blot. (B) Piezo1 and HDAC2 mRNA level of dHL-60 cells was determined by RT-qPCR, normalized to the amount of β-actin. (C) Immunofluorescent staining of the Piezo1 expression of dHL-60 cells. Scale bar, 50 μm. (D) Intracellular Ca 2+ concentration of dHL-60 cells. (E) Intracellular ROS levels of dHL-60 cells. The data are presented as the mean ± SEM. (n=3). * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: bioRxiv

Article Title: Lower shear stress exacerbates atherosclerosis by inducing the generation of neutrophil extracellular traps via Piezo1-mediated mechanosensation

doi: 10.1101/2023.02.19.529165

Figure Lengend Snippet: LSS downregulates Piezo1 and elevates reactive oxygen species (ROS) levels. dHL-60 cells were exposed to LSS or PSS for 24h. (A) Piezo1 and HDAC2 protein expression of dHL-60 cells were determined by Western blot. (B) Piezo1 and HDAC2 mRNA level of dHL-60 cells was determined by RT-qPCR, normalized to the amount of β-actin. (C) Immunofluorescent staining of the Piezo1 expression of dHL-60 cells. Scale bar, 50 μm. (D) Intracellular Ca 2+ concentration of dHL-60 cells. (E) Intracellular ROS levels of dHL-60 cells. The data are presented as the mean ± SEM. (n=3). * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: The dHL-60 cells were incubated with the Piezo1 agonist Yoda1 (1 μM, #HY-18723, MedChem Express, New Jersey, USA) for 24 h, the HDAC2 inhibitor valproic acid sodium (VPA, 5 mM, #HY-10585A, MedChem Express, New Jersey, USA), or agonist Theophylline (5 μM, #HY-B0809, MedChem Express, New Jersey, USA) for 6h, respectively.

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Staining, Concentration Assay

Piezo1 knockdown promotes neutrophil extracellular traps (NETs) generation in dHL-60 cells and Piezo1 overexpression attenuates LSS-induced dHL-60 cells NETosis in vitro . (A) Representative immunoblots and corresponding densitometry analysis of CitH 3 and HDAC2 protein abundance in dHL-60 cells transfected with Piezo1 siRNA. (B) Immunofluorescence of CitH 3 and MPO in dHL-60 cells transfected with Piezo1 siRNA. Scale bar: 50 μm. (C) HDAC2 mRNA level of Piezo1 knockdown dHL-60 cells was determined by RT-qPCR, normalized to the amount of β-actin. (D) Representative immunoblots and corresponding densitometry analysis of CitH 3 and HDAC2 protein abundance in dHL-60 cells of LSS, Yoda1 and Yoda1+LSS group. (E) Immunofluorescence of CitH 3 (green), MPO (red) and DPAI (blue) in dHL-60 cells of LSS, Yoda1 and Yoda1+LSS group. Scale bar: 50 μm. Flow cytometry analysis of intracellular Ca2+ (F) and ROS concentrations (G) of dHL-60 cells transfected with Piezo1 siRNA. Flow cytometry analysis of intracellular Ca2+ (H) and ROS concentrations (I) of dHL-60 cells treated with Yoda1. The data are presented as the mean ± SEM. (n=3). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: bioRxiv

Article Title: Lower shear stress exacerbates atherosclerosis by inducing the generation of neutrophil extracellular traps via Piezo1-mediated mechanosensation

doi: 10.1101/2023.02.19.529165

Figure Lengend Snippet: Piezo1 knockdown promotes neutrophil extracellular traps (NETs) generation in dHL-60 cells and Piezo1 overexpression attenuates LSS-induced dHL-60 cells NETosis in vitro . (A) Representative immunoblots and corresponding densitometry analysis of CitH 3 and HDAC2 protein abundance in dHL-60 cells transfected with Piezo1 siRNA. (B) Immunofluorescence of CitH 3 and MPO in dHL-60 cells transfected with Piezo1 siRNA. Scale bar: 50 μm. (C) HDAC2 mRNA level of Piezo1 knockdown dHL-60 cells was determined by RT-qPCR, normalized to the amount of β-actin. (D) Representative immunoblots and corresponding densitometry analysis of CitH 3 and HDAC2 protein abundance in dHL-60 cells of LSS, Yoda1 and Yoda1+LSS group. (E) Immunofluorescence of CitH 3 (green), MPO (red) and DPAI (blue) in dHL-60 cells of LSS, Yoda1 and Yoda1+LSS group. Scale bar: 50 μm. Flow cytometry analysis of intracellular Ca2+ (F) and ROS concentrations (G) of dHL-60 cells transfected with Piezo1 siRNA. Flow cytometry analysis of intracellular Ca2+ (H) and ROS concentrations (I) of dHL-60 cells treated with Yoda1. The data are presented as the mean ± SEM. (n=3). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: The dHL-60 cells were incubated with the Piezo1 agonist Yoda1 (1 μM, #HY-18723, MedChem Express, New Jersey, USA) for 24 h, the HDAC2 inhibitor valproic acid sodium (VPA, 5 mM, #HY-10585A, MedChem Express, New Jersey, USA), or agonist Theophylline (5 μM, #HY-B0809, MedChem Express, New Jersey, USA) for 6h, respectively.

Techniques: Knockdown, Over Expression, In Vitro, Western Blot, Quantitative Proteomics, Transfection, Immunofluorescence, Quantitative RT-PCR, Flow Cytometry

HDAC2 inhibition affects little of the expression of piezo1 and NETosis. Static and Piezo1 knockdown dHL-60 cells treated with valproic acid sodium (VPA) or not. Yoda1 attenuates NETosis induced by HDAC2 overexpression in dHL-60 cells. Static dHL-60 cells treated with Theophylline or not. (A and B) Representative immunoblots and corresponding densitometry analysis of Piezo1 and CitH 3 protein abundance in dHL-60 cells under different treatments. Immunofluorescence of CitH 3 (green) (C and E), Piezo1 (green) (D and F), MPO (red), and DPAI (blue) in dHL-60 cells under different treatments. Scale bar: 50 μm. Flow cytometry was used to detect the intracellular Ca2+ (G and I) and ROS (H and J) concentrations of dHL-60 cells under different treatments. The data are presented as the mean ± SEM. (n=3). * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: bioRxiv

Article Title: Lower shear stress exacerbates atherosclerosis by inducing the generation of neutrophil extracellular traps via Piezo1-mediated mechanosensation

doi: 10.1101/2023.02.19.529165

Figure Lengend Snippet: HDAC2 inhibition affects little of the expression of piezo1 and NETosis. Static and Piezo1 knockdown dHL-60 cells treated with valproic acid sodium (VPA) or not. Yoda1 attenuates NETosis induced by HDAC2 overexpression in dHL-60 cells. Static dHL-60 cells treated with Theophylline or not. (A and B) Representative immunoblots and corresponding densitometry analysis of Piezo1 and CitH 3 protein abundance in dHL-60 cells under different treatments. Immunofluorescence of CitH 3 (green) (C and E), Piezo1 (green) (D and F), MPO (red), and DPAI (blue) in dHL-60 cells under different treatments. Scale bar: 50 μm. Flow cytometry was used to detect the intracellular Ca2+ (G and I) and ROS (H and J) concentrations of dHL-60 cells under different treatments. The data are presented as the mean ± SEM. (n=3). * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: The dHL-60 cells were incubated with the Piezo1 agonist Yoda1 (1 μM, #HY-18723, MedChem Express, New Jersey, USA) for 24 h, the HDAC2 inhibitor valproic acid sodium (VPA, 5 mM, #HY-10585A, MedChem Express, New Jersey, USA), or agonist Theophylline (5 μM, #HY-B0809, MedChem Express, New Jersey, USA) for 6h, respectively.

Techniques: Inhibition, Expressing, Knockdown, Over Expression, Western Blot, Quantitative Proteomics, Immunofluorescence, Flow Cytometry

Piezo1 is expressed in primary microglia (A) The relative expression of mechanically activated ion channel mRNA in primary microglia was analyzed by real-time RT-PCR using the ΔΔCT method. Bars represent mean ± SEM N = 3 independent experiments. Two-tailed unpaired t-test. ∗p < 0.05. (B) Representative traces of Yoda1-induced inward currents in primary microglia recorded at −60 mV under the indicated conditions. (C) Scatterplots of Yoda1-induced inward currents in the indicated conditions. Bars represent mean ± SEM N = 4 in the Yoda1 group, n = 5 in the GsMTx4+Yoda1 group. Two-tailed unpaired t-test. ∗p < 0.05. (D) Representative live-cell imaging of primary microglia loaded with Fura-2 at rest state (upper panel) and at the time of maximum fluorescence (lower panel). Scale bar = 20 μm (E) Representative calcium imaging traces of Fura-2 (F340/F380 ratio) in primary microglia treated with different Yoda1 and/or GsMTx4 concentrations. (F) Statistical analysis of ΔF/F0 (%) in primary microglia under different Yoda1 and/or GsMTx4 concentrations. Bars represent the mean ± SD N = 3 independent experiments; 20-30 cells analyzed per experiment. Two-tailed Mann-Whitney U test. ∗∗∗∗p < 0.0001.

Journal: iScience

Article Title: The mechanosensitive ion channel Piezo1 modulates the migration and immune response of microglia

doi: 10.1016/j.isci.2023.105993

Figure Lengend Snippet: Piezo1 is expressed in primary microglia (A) The relative expression of mechanically activated ion channel mRNA in primary microglia was analyzed by real-time RT-PCR using the ΔΔCT method. Bars represent mean ± SEM N = 3 independent experiments. Two-tailed unpaired t-test. ∗p < 0.05. (B) Representative traces of Yoda1-induced inward currents in primary microglia recorded at −60 mV under the indicated conditions. (C) Scatterplots of Yoda1-induced inward currents in the indicated conditions. Bars represent mean ± SEM N = 4 in the Yoda1 group, n = 5 in the GsMTx4+Yoda1 group. Two-tailed unpaired t-test. ∗p < 0.05. (D) Representative live-cell imaging of primary microglia loaded with Fura-2 at rest state (upper panel) and at the time of maximum fluorescence (lower panel). Scale bar = 20 μm (E) Representative calcium imaging traces of Fura-2 (F340/F380 ratio) in primary microglia treated with different Yoda1 and/or GsMTx4 concentrations. (F) Statistical analysis of ΔF/F0 (%) in primary microglia under different Yoda1 and/or GsMTx4 concentrations. Bars represent the mean ± SD N = 3 independent experiments; 20-30 cells analyzed per experiment. Two-tailed Mann-Whitney U test. ∗∗∗∗p < 0.0001.

Article Snippet: To generate Piezo1 knockout (KO) cell lines, single guide RNAs (sgRNAs) ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference was inserted into MLM3636 vector (Addgene Plasmid #43860).

Techniques: Expressing, Quantitative RT-PCR, Two Tailed Test, Live Cell Imaging, Fluorescence, Imaging, MANN-WHITNEY

Piezo1 deficiency in microglia affects the expression profiles of genes (A) Schematic illustration of the Piezo1 conditional knock out mice and treatment scheme with tamoxifen. (B) Schematic illustration of RNA-seq preparation procedure. (C) Volcano plot showing Piezo1 ΔTmem119 vs. Piezo1 fl/+ differentially expressed genes by RNA-seq based on primary microglia isolated from Piezo1 conditional knock out mice. (D) Heatmap showing the top 50 differentially expressed genes, Piezo1 ΔTmem119 vs. Piezo1 fl/+ . (E) The top 20 significantly enriched terms in the gene ontology (GO) enrichment analysis.

Journal: iScience

Article Title: The mechanosensitive ion channel Piezo1 modulates the migration and immune response of microglia

doi: 10.1016/j.isci.2023.105993

Figure Lengend Snippet: Piezo1 deficiency in microglia affects the expression profiles of genes (A) Schematic illustration of the Piezo1 conditional knock out mice and treatment scheme with tamoxifen. (B) Schematic illustration of RNA-seq preparation procedure. (C) Volcano plot showing Piezo1 ΔTmem119 vs. Piezo1 fl/+ differentially expressed genes by RNA-seq based on primary microglia isolated from Piezo1 conditional knock out mice. (D) Heatmap showing the top 50 differentially expressed genes, Piezo1 ΔTmem119 vs. Piezo1 fl/+ . (E) The top 20 significantly enriched terms in the gene ontology (GO) enrichment analysis.

Article Snippet: To generate Piezo1 knockout (KO) cell lines, single guide RNAs (sgRNAs) ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference was inserted into MLM3636 vector (Addgene Plasmid #43860).

Techniques: Expressing, Knock-Out, RNA Sequencing, Isolation

Piezo1 regulates the migration ability of microglia both in vivo and in vitro (A) Representative images of migrated primary microglia stained with DAPI, treated with 1% DMSO, Yoda1 (10 μM) 1% H 2 O, and GsMTx4 (10 μM) respectively, attracted by 10% FBS. Scale bar = 50um. (B) Quantification of migrated cell numbers treated with 1% DMSO, Yoda1 (10 μM) 1% H2O, and GsMTx4 (10 μM) attracted by 10% FBS. Bars represent mean ± SD Repeated 3 times. Two-tailed unpaired t test. ∗∗p < 0.01, ∗∗∗∗p < 0.0001. (C) Representative traces of 30 μM Yoda1 induced inward currents in BV2-WT and BV2-Piezo1 KO cells recorded at −60 mV in the indicated conditions. (D) Quantification of 30 μM Yoda1-induced inward currents in BV2-WT or BV2-Piezo1 KO cells. Bars represent mean ± SD N = 3 cells for each group. Two-tailed unpaired t test. ∗p < 0.05. (E) Representative time course of calcium fluorescence in BV2-WT and BV2 - Piezo1 KO cells treated with 2 μM Yoda1. (F) Statistical analysis of ΔF/F0 (%) in BV2-WT and BV2-Piezo1 KO cells under different Yoda1 concentrations. Bars represent mean ± SEM N = 3 experiments; 30-40 cells were analyzed for each experiment. Two-tailed Mann-Whitney U test. ∗∗∗∗p < 0.0001. (G) Representative images of migrated BV2-WT or BV2-Piezo1 KO cells stained by crystal violet, attracted by FBS or Aβ 1-42 respectively. Scale bar = 100μm. (H) Quantification of migrated BV2-WT or BV2-Piezo1 KO cell numbers attracted by FBS or Aβ 1-42 respectively. Bars represent mean ± SD Repeated 3 times. Two-tailed unpaired t test. ∗∗p < 0.01. (I) Representative images of Aβ 1-42 injected regions in the dentate gyrus (DG) region of Piezo1 fl/+ and Piezo1 ΔTmem119 mouse groups respectively. Scale bar = 50 μm (J) Quantified average values for total Aβ-555/IBA1 positive (IBA1+) cells, normalized to control group (n = 6 in Piezo1 fl/+ group, n = 5 in Piezo1 ΔTmem119 group). Bars represent mean ± SD Two-tailed unpaired t test. ∗∗p < 0.01. (K) Representative images of IBA1 positive cells in DG area of Piezo1 fl/+ and Piezo1 ΔTmem119 brain slice respectively (blue: DAPI, green: IBA1). Scale bar = 100 μm (L) Quantification of microglia numbers per mm 2 around DG area in Piezo1 fl/+ and Piezo1 ΔTmem119 mice respectively (n = 5 in Piezo1 fl/+ group, n = 6 in Piezo1 ΔTmem119 group). Bars represent mean ± SEM Two-tailed unpaired t test. n.s., no significance.

Journal: iScience

Article Title: The mechanosensitive ion channel Piezo1 modulates the migration and immune response of microglia

doi: 10.1016/j.isci.2023.105993

Figure Lengend Snippet: Piezo1 regulates the migration ability of microglia both in vivo and in vitro (A) Representative images of migrated primary microglia stained with DAPI, treated with 1% DMSO, Yoda1 (10 μM) 1% H 2 O, and GsMTx4 (10 μM) respectively, attracted by 10% FBS. Scale bar = 50um. (B) Quantification of migrated cell numbers treated with 1% DMSO, Yoda1 (10 μM) 1% H2O, and GsMTx4 (10 μM) attracted by 10% FBS. Bars represent mean ± SD Repeated 3 times. Two-tailed unpaired t test. ∗∗p < 0.01, ∗∗∗∗p < 0.0001. (C) Representative traces of 30 μM Yoda1 induced inward currents in BV2-WT and BV2-Piezo1 KO cells recorded at −60 mV in the indicated conditions. (D) Quantification of 30 μM Yoda1-induced inward currents in BV2-WT or BV2-Piezo1 KO cells. Bars represent mean ± SD N = 3 cells for each group. Two-tailed unpaired t test. ∗p < 0.05. (E) Representative time course of calcium fluorescence in BV2-WT and BV2 - Piezo1 KO cells treated with 2 μM Yoda1. (F) Statistical analysis of ΔF/F0 (%) in BV2-WT and BV2-Piezo1 KO cells under different Yoda1 concentrations. Bars represent mean ± SEM N = 3 experiments; 30-40 cells were analyzed for each experiment. Two-tailed Mann-Whitney U test. ∗∗∗∗p < 0.0001. (G) Representative images of migrated BV2-WT or BV2-Piezo1 KO cells stained by crystal violet, attracted by FBS or Aβ 1-42 respectively. Scale bar = 100μm. (H) Quantification of migrated BV2-WT or BV2-Piezo1 KO cell numbers attracted by FBS or Aβ 1-42 respectively. Bars represent mean ± SD Repeated 3 times. Two-tailed unpaired t test. ∗∗p < 0.01. (I) Representative images of Aβ 1-42 injected regions in the dentate gyrus (DG) region of Piezo1 fl/+ and Piezo1 ΔTmem119 mouse groups respectively. Scale bar = 50 μm (J) Quantified average values for total Aβ-555/IBA1 positive (IBA1+) cells, normalized to control group (n = 6 in Piezo1 fl/+ group, n = 5 in Piezo1 ΔTmem119 group). Bars represent mean ± SD Two-tailed unpaired t test. ∗∗p < 0.01. (K) Representative images of IBA1 positive cells in DG area of Piezo1 fl/+ and Piezo1 ΔTmem119 brain slice respectively (blue: DAPI, green: IBA1). Scale bar = 100 μm (L) Quantification of microglia numbers per mm 2 around DG area in Piezo1 fl/+ and Piezo1 ΔTmem119 mice respectively (n = 5 in Piezo1 fl/+ group, n = 6 in Piezo1 ΔTmem119 group). Bars represent mean ± SEM Two-tailed unpaired t test. n.s., no significance.

Article Snippet: To generate Piezo1 knockout (KO) cell lines, single guide RNAs (sgRNAs) ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference was inserted into MLM3636 vector (Addgene Plasmid #43860).

Techniques: Migration, In Vivo, In Vitro, Staining, Two Tailed Test, Fluorescence, MANN-WHITNEY, Injection, Control, Slice Preparation

Piezo1 regulates the production of pro-inflammatory cytokines by microglia when challenged by LPS both in vivo and in vitro (A-C) Relative mRNA expression of IL-1β, IL-6, and TNF-α in BV2-WT cells, exposed to Yoda1 (10 μM) or not, in basal state or stimulated by LPS (100 ng/mL), normalized to BV2 basal control state. Bars represent mean ± SD N = 5 independent experiments. two-way ANOVA, n.s., no significance, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. (D-F) Relative mRNA expression of IL-1β, IL-6, and TNF-α of BV2-WT and BV2-Piezo1 KO cells in basal state or stimulated by LPS (100 ;ng/mL), normalized to BV2-WT basal state. Bars represent mean ± SD N = 5 independent experiments. two-way ANOVA, n.s., no significance, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. (G) Representative western blot images for IL-1 β and GAPDH in indicated conditions. (H) Quantification of IL-1 β protein levels normalized to GAPDH compared with BV2-WT treated with LPS group. Bars represent mean ± SD N = 3 independent experiments. Two-tailed unpaired T test. n.s., no significance, ∗p < 0.05, ∗∗p < 0.01. (I-K) Relative mRNA expression of IL-1β, IL-6, and TNF-α in the cortex of Piezo1 fl/+ and Piezo1 ΔTMEM119 mice in basal state or after the administration of LPS (n = 3 in Piezo1 fl/+ -LPS group, n = 4 in Piezo1 ΔTmem119 -LPS group, n = 3 in Piezo1 fl/+ +LPS group, n = 3 in Piezo1 ΔTmem119 + LPS group). Bars represent mean ± SEM For panel A-F and I-K. two-way ANOVA, n.s., no significance, ∗p < 0.05, ∗∗∗p < 0.001.

Journal: iScience

Article Title: The mechanosensitive ion channel Piezo1 modulates the migration and immune response of microglia

doi: 10.1016/j.isci.2023.105993

Figure Lengend Snippet: Piezo1 regulates the production of pro-inflammatory cytokines by microglia when challenged by LPS both in vivo and in vitro (A-C) Relative mRNA expression of IL-1β, IL-6, and TNF-α in BV2-WT cells, exposed to Yoda1 (10 μM) or not, in basal state or stimulated by LPS (100 ng/mL), normalized to BV2 basal control state. Bars represent mean ± SD N = 5 independent experiments. two-way ANOVA, n.s., no significance, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. (D-F) Relative mRNA expression of IL-1β, IL-6, and TNF-α of BV2-WT and BV2-Piezo1 KO cells in basal state or stimulated by LPS (100 ;ng/mL), normalized to BV2-WT basal state. Bars represent mean ± SD N = 5 independent experiments. two-way ANOVA, n.s., no significance, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. (G) Representative western blot images for IL-1 β and GAPDH in indicated conditions. (H) Quantification of IL-1 β protein levels normalized to GAPDH compared with BV2-WT treated with LPS group. Bars represent mean ± SD N = 3 independent experiments. Two-tailed unpaired T test. n.s., no significance, ∗p < 0.05, ∗∗p < 0.01. (I-K) Relative mRNA expression of IL-1β, IL-6, and TNF-α in the cortex of Piezo1 fl/+ and Piezo1 ΔTMEM119 mice in basal state or after the administration of LPS (n = 3 in Piezo1 fl/+ -LPS group, n = 4 in Piezo1 ΔTmem119 -LPS group, n = 3 in Piezo1 fl/+ +LPS group, n = 3 in Piezo1 ΔTmem119 + LPS group). Bars represent mean ± SEM For panel A-F and I-K. two-way ANOVA, n.s., no significance, ∗p < 0.05, ∗∗∗p < 0.001.

Article Snippet: To generate Piezo1 knockout (KO) cell lines, single guide RNAs (sgRNAs) ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference was inserted into MLM3636 vector (Addgene Plasmid #43860).

Techniques: In Vivo, In Vitro, Expressing, Control, Western Blot, Two Tailed Test

Stiffness-dependent Piezo1 expression/activity modulates microglia migration and pro-inflammatory cytokines production (A) Representative images of migrated BV2-WT or Piezo1-KO cells pre-cultured for 48h in PA gel of varying stiffness (Soft: 0.6 KPa, Stiff: 35 KPa) stained by crystal violet. Scale bar = 100um. (B) Quantification of migrated cell numbers of BV2-WT or Piezo1-KO cells pre-cultured for 48h in PA gel of different stiffness (Soft: 0.6 KPa, Stiff: 35 KPa). Bars represent mean ± SD N = 3 independent experiments. two-way ANOVA, n.s., no significance, ∗p < 0.05, ∗∗p < 0.01. (C-E) Relative IL-1β, IL-6, and TNF-α mRNA expression of BV2-WT and BV2-Piezo1 KO seeded on surfaces of indicated stiffness (Soft: 0.6 KPa, Stiff: 35 KPa). Bars represent mean ± SEM N = 5 independent experiments. two-way ANOVA, n.s., no significance; ∗p < 0.05, ∗∗∗∗p < 0.0001. (F) Immunofluorescence confocal images of Piezo1 (green) in BV2 cell lines seeding on different stiffness of PA gel (Soft: 0.6 KPa, Stiff: 35 KPa). Scale bar = 20 μm (G) Quantification of Piezo1 mean fluorescent intensity (MFI) of BV2 cells seeding on different stiffness of PA gel. Bars represent mean ± SD Repeated 3 times, around 30 cells were analyzed for each experiment. Two-tailed unpaired t test. ∗∗∗∗p < 0.0001. (H) Relative Piezo1 mRNA levels of BV2 cell lines seeding on different stiffness of PA gel. Bars represent mean ± SEM N = 4 independent experiments. Two-tailed unpaired t test. ∗p < 0.05. (I) Representative live-cell imaging of BV2 cells loaded with Fura2 calcium indicator treated with Yoda1 (10 μM) at time 0 (left panel) and at the time of maximum fluorescence (right panel) seeding on soft and stiff substrate respectively. Scale bar = 20 μm (J) Representative calcium imaging traces of Fura-2 (F340/F380 ratio) in BV2 cells seeding on soft (black curve) and stiff substrates (red curve) treated with Yoda1 (10 μM). (K) Statistical analysis of ΔF/F0 (%) of BV2 cells seeding on soft (black) and stiff substrates (red) induced by Yoda1 (10 μM). Bars represent mean ± SD N = 3 independent experiments, 20-30 cells were analyzed for each experiment. Two-tailed Mann-Whitney U test. ∗∗∗∗p < 0.0001.

Journal: iScience

Article Title: The mechanosensitive ion channel Piezo1 modulates the migration and immune response of microglia

doi: 10.1016/j.isci.2023.105993

Figure Lengend Snippet: Stiffness-dependent Piezo1 expression/activity modulates microglia migration and pro-inflammatory cytokines production (A) Representative images of migrated BV2-WT or Piezo1-KO cells pre-cultured for 48h in PA gel of varying stiffness (Soft: 0.6 KPa, Stiff: 35 KPa) stained by crystal violet. Scale bar = 100um. (B) Quantification of migrated cell numbers of BV2-WT or Piezo1-KO cells pre-cultured for 48h in PA gel of different stiffness (Soft: 0.6 KPa, Stiff: 35 KPa). Bars represent mean ± SD N = 3 independent experiments. two-way ANOVA, n.s., no significance, ∗p < 0.05, ∗∗p < 0.01. (C-E) Relative IL-1β, IL-6, and TNF-α mRNA expression of BV2-WT and BV2-Piezo1 KO seeded on surfaces of indicated stiffness (Soft: 0.6 KPa, Stiff: 35 KPa). Bars represent mean ± SEM N = 5 independent experiments. two-way ANOVA, n.s., no significance; ∗p < 0.05, ∗∗∗∗p < 0.0001. (F) Immunofluorescence confocal images of Piezo1 (green) in BV2 cell lines seeding on different stiffness of PA gel (Soft: 0.6 KPa, Stiff: 35 KPa). Scale bar = 20 μm (G) Quantification of Piezo1 mean fluorescent intensity (MFI) of BV2 cells seeding on different stiffness of PA gel. Bars represent mean ± SD Repeated 3 times, around 30 cells were analyzed for each experiment. Two-tailed unpaired t test. ∗∗∗∗p < 0.0001. (H) Relative Piezo1 mRNA levels of BV2 cell lines seeding on different stiffness of PA gel. Bars represent mean ± SEM N = 4 independent experiments. Two-tailed unpaired t test. ∗p < 0.05. (I) Representative live-cell imaging of BV2 cells loaded with Fura2 calcium indicator treated with Yoda1 (10 μM) at time 0 (left panel) and at the time of maximum fluorescence (right panel) seeding on soft and stiff substrate respectively. Scale bar = 20 μm (J) Representative calcium imaging traces of Fura-2 (F340/F380 ratio) in BV2 cells seeding on soft (black curve) and stiff substrates (red curve) treated with Yoda1 (10 μM). (K) Statistical analysis of ΔF/F0 (%) of BV2 cells seeding on soft (black) and stiff substrates (red) induced by Yoda1 (10 μM). Bars represent mean ± SD N = 3 independent experiments, 20-30 cells were analyzed for each experiment. Two-tailed Mann-Whitney U test. ∗∗∗∗p < 0.0001.

Article Snippet: To generate Piezo1 knockout (KO) cell lines, single guide RNAs (sgRNAs) ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference was inserted into MLM3636 vector (Addgene Plasmid #43860).

Techniques: Expressing, Activity Assay, Migration, Cell Culture, Staining, Immunofluorescence, Two Tailed Test, Live Cell Imaging, Fluorescence, Imaging, MANN-WHITNEY

Journal: iScience

Article Title: The mechanosensitive ion channel Piezo1 modulates the migration and immune response of microglia

doi: 10.1016/j.isci.2023.105993

Figure Lengend Snippet:

Article Snippet: To generate Piezo1 knockout (KO) cell lines, single guide RNAs (sgRNAs) ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference was inserted into MLM3636 vector (Addgene Plasmid #43860).

Techniques: Virus, Recombinant, Lysis, Transfection, RNA Extraction, Bicinchoninic Acid Protein Assay, Membrane, Transgenic Assay, Plasmid Preparation, Software

SNI induces Piezo1 overexpression in ACC neurons. ( A ) SNI-induced bilateral expression of Piezo1 in the ACC. Left, Cg1 and Cg2 tissues were used for Western blotting. Coronal dissection was performed 3.0–0.5 mm anterior to the Bregma. A representative Western blot of Piezo1 expression in the bilateral ACC is shown in the middle. The protein quantification results from Western blotting are shown on the right. Significant differences in Piezo1 expression were observed on both sides of the ACC 7 d after SNI. * p -value < 0.05, ** p -value < 0.01 versus the sham group (two-way ANOVA). ( B – D ) Representative double immunofluorescence staining showing the overlap (yellow) of Piezo1-IR (red) with neuronal marker NeuN (green), but not with microglial marker Iba1 (green) and astrocyte marker GFAP (green), 7 d after SNI. The arrowhead in ( C ) indicates Iba1-IR surrounding or partially overlapping Piezo1-IR. Scale bar = 50 μm. The fluorescence intensity curves for red and green signals in the boxed areas are shown on the right side for each group.

Journal: International Journal of Molecular Sciences

Article Title: NLRP3-Mediated Piezo1 Upregulation in ACC Inhibitory Parvalbumin-Expressing Interneurons Is Involved in Pain Processing after Peripheral Nerve Injury

doi: 10.3390/ijms232113035

Figure Lengend Snippet: SNI induces Piezo1 overexpression in ACC neurons. ( A ) SNI-induced bilateral expression of Piezo1 in the ACC. Left, Cg1 and Cg2 tissues were used for Western blotting. Coronal dissection was performed 3.0–0.5 mm anterior to the Bregma. A representative Western blot of Piezo1 expression in the bilateral ACC is shown in the middle. The protein quantification results from Western blotting are shown on the right. Significant differences in Piezo1 expression were observed on both sides of the ACC 7 d after SNI. * p -value < 0.05, ** p -value < 0.01 versus the sham group (two-way ANOVA). ( B – D ) Representative double immunofluorescence staining showing the overlap (yellow) of Piezo1-IR (red) with neuronal marker NeuN (green), but not with microglial marker Iba1 (green) and astrocyte marker GFAP (green), 7 d after SNI. The arrowhead in ( C ) indicates Iba1-IR surrounding or partially overlapping Piezo1-IR. Scale bar = 50 μm. The fluorescence intensity curves for red and green signals in the boxed areas are shown on the right side for each group.

Article Snippet: Incubation with anti-Piezo1 antibody (1:100, Alomone, Jerusalem, Israel) plus either anti-Parvalbumin antibody (1:500, NOVUS, Littleton, CO, USA), anti-CaMKⅡ recombinant rabbit monoclonal antibody (1:200, HuaBio, Zhejiang, China), anti-CD68 antibody (1:200; Abcam, Cambridge, UK) or anti-NLRP3 antibody (1:100, Affinity, Cincinnati, OH, USA) was performed overnight at 4 °C.

Techniques: Over Expression, Expressing, Western Blot, Dissection, Double Immunofluorescence Staining, Marker, Fluorescence

SNI-induced Piezo1 is preferentially expressed in ACC PV-INs. ( A ) Representative double staining image showing the overlap (white arrows) of Piezo1-IR (red) with PV (inhibitory interneuron marker, green, below), but not with CaMK II (glutamate neuronal marker, green, top), 7 d after SNI. The color of co-localization is yellow. Blue fluorescence is from DAPI, a nuclear counterstain. Scale bar = 100 μm. ( B ) Quantitative analysis of Piezo1-IR neurons co-localized with PV-IR and CaMKⅡ-IR neurons.

Journal: International Journal of Molecular Sciences

Article Title: NLRP3-Mediated Piezo1 Upregulation in ACC Inhibitory Parvalbumin-Expressing Interneurons Is Involved in Pain Processing after Peripheral Nerve Injury

doi: 10.3390/ijms232113035

Figure Lengend Snippet: SNI-induced Piezo1 is preferentially expressed in ACC PV-INs. ( A ) Representative double staining image showing the overlap (white arrows) of Piezo1-IR (red) with PV (inhibitory interneuron marker, green, below), but not with CaMK II (glutamate neuronal marker, green, top), 7 d after SNI. The color of co-localization is yellow. Blue fluorescence is from DAPI, a nuclear counterstain. Scale bar = 100 μm. ( B ) Quantitative analysis of Piezo1-IR neurons co-localized with PV-IR and CaMKⅡ-IR neurons.

Article Snippet: Incubation with anti-Piezo1 antibody (1:100, Alomone, Jerusalem, Israel) plus either anti-Parvalbumin antibody (1:500, NOVUS, Littleton, CO, USA), anti-CaMKⅡ recombinant rabbit monoclonal antibody (1:200, HuaBio, Zhejiang, China), anti-CD68 antibody (1:200; Abcam, Cambridge, UK) or anti-NLRP3 antibody (1:100, Affinity, Cincinnati, OH, USA) was performed overnight at 4 °C.

Techniques: Double Staining, Marker, Fluorescence

The effect of recombinant rat TNF-α (rrTNF) on the expression levels of Piezo1 and NLRP3 in cellular experiments. ( A ) A representative Western blot showing Piezo1 and NLRP3 protein levels after the treatment of BV2 cells with different doses of rrTNF (0, 1, 5, and 10 ng/mL) is presented on the left. The protein quantifications are shown on the right. ** p -value < 0.01, *** p -value < 0.001 versus the control (0 ng/mL) group (two-way ANOVA). ( B ) Left: Representative double staining showing changes in the immunofluorescence intensities of caspase-1 (green) and IL-1β (red) following treatment of cultured BV2 cells with different doses of rrTNF (0, 1, 5, and 10 ng/mL) and the effect of the NLRP3 inhibitor MCC950 on the rrTNF-mediated induction of caspase-1 (green) and IL-1β in BV2 cells. Blue fluorescence is from DAPI. Scale bar = 50 μm. Right: Quantitative analysis of the fluorescence intensities of caspase-1 and IL-1β in the different groups. * p -value < 0.05, ** p -value < 0.01 (one-way ANOVA). ( C ) Representative Western blot showing Piezo1 and NLRP3 protein levels following the treatment of the primary ACC neuron culture with rrTNF (5 ng/mL) and the effect of the Piezo1 inhibitor GsMTx4 on these rrTNF-mediated inductions are shown on the top. The quantification results are presented below. * p -value < 0.05, ** p -value < 0.01, *** p -value < 0.001 versus the control (one-way ANOVA).

Journal: International Journal of Molecular Sciences

Article Title: NLRP3-Mediated Piezo1 Upregulation in ACC Inhibitory Parvalbumin-Expressing Interneurons Is Involved in Pain Processing after Peripheral Nerve Injury

doi: 10.3390/ijms232113035

Figure Lengend Snippet: The effect of recombinant rat TNF-α (rrTNF) on the expression levels of Piezo1 and NLRP3 in cellular experiments. ( A ) A representative Western blot showing Piezo1 and NLRP3 protein levels after the treatment of BV2 cells with different doses of rrTNF (0, 1, 5, and 10 ng/mL) is presented on the left. The protein quantifications are shown on the right. ** p -value < 0.01, *** p -value < 0.001 versus the control (0 ng/mL) group (two-way ANOVA). ( B ) Left: Representative double staining showing changes in the immunofluorescence intensities of caspase-1 (green) and IL-1β (red) following treatment of cultured BV2 cells with different doses of rrTNF (0, 1, 5, and 10 ng/mL) and the effect of the NLRP3 inhibitor MCC950 on the rrTNF-mediated induction of caspase-1 (green) and IL-1β in BV2 cells. Blue fluorescence is from DAPI. Scale bar = 50 μm. Right: Quantitative analysis of the fluorescence intensities of caspase-1 and IL-1β in the different groups. * p -value < 0.05, ** p -value < 0.01 (one-way ANOVA). ( C ) Representative Western blot showing Piezo1 and NLRP3 protein levels following the treatment of the primary ACC neuron culture with rrTNF (5 ng/mL) and the effect of the Piezo1 inhibitor GsMTx4 on these rrTNF-mediated inductions are shown on the top. The quantification results are presented below. * p -value < 0.05, ** p -value < 0.01, *** p -value < 0.001 versus the control (one-way ANOVA).

Article Snippet: Incubation with anti-Piezo1 antibody (1:100, Alomone, Jerusalem, Israel) plus either anti-Parvalbumin antibody (1:500, NOVUS, Littleton, CO, USA), anti-CaMKⅡ recombinant rabbit monoclonal antibody (1:200, HuaBio, Zhejiang, China), anti-CD68 antibody (1:200; Abcam, Cambridge, UK) or anti-NLRP3 antibody (1:100, Affinity, Cincinnati, OH, USA) was performed overnight at 4 °C.

Techniques: Recombinant, Expressing, Western Blot, Double Staining, Immunofluorescence, Cell Culture, Fluorescence

The effect of NLRP3 inhibition on SNI-induced Piezo1 upregulation and pain behavior. ( A ) Representative double staining showing the overlap of NLRP3-IR (red) with NeuN, Iba1 and GFAP (green), 7 d after SNI. NLRP3-IR (green) also colocalized with Piezo1-IR neurons (red). White arrow shows the co-localization (yellow). Scale bar = 50 μm. ( B ) Representative double immunofluorescence staining image showing the encapsulation of PV-IR by GSDMD-IR, a pore-forming protein downstream to NLRP3 inflammasome. Scale bar = 50 μm. Blue fluorescence in (A and B) is from DAPI. ( C ) Representative Western blot showing the effect of the NLRP3 inhibitor MCC950 (10 mg/kg i.p., once a day for 7 days) on the Piezo1 protein level in the bilateral ACC (top). Protein quantification results (bottom). * p -value < 0.05, ** p -value < 0.01 (two-way ANOVA). ( D ) Changes in ipsilateral paw withdrawal thresholds in sham, SNI + PBS, and SNI + MCC950 group. Significant differences in the threshold were observed in SNI + PBS rats but not SNI + MCC950 rats compared with sham rats on PO days 5, 11 and 15 ( n = 6). * p -value < 0.05 versus PO day −1 (Dunn’s multiple comparisons test) or # p -value < 0.05, ## p -value < 0.01 versus the sham group (multiple t test).

Journal: International Journal of Molecular Sciences

Article Title: NLRP3-Mediated Piezo1 Upregulation in ACC Inhibitory Parvalbumin-Expressing Interneurons Is Involved in Pain Processing after Peripheral Nerve Injury

doi: 10.3390/ijms232113035

Figure Lengend Snippet: The effect of NLRP3 inhibition on SNI-induced Piezo1 upregulation and pain behavior. ( A ) Representative double staining showing the overlap of NLRP3-IR (red) with NeuN, Iba1 and GFAP (green), 7 d after SNI. NLRP3-IR (green) also colocalized with Piezo1-IR neurons (red). White arrow shows the co-localization (yellow). Scale bar = 50 μm. ( B ) Representative double immunofluorescence staining image showing the encapsulation of PV-IR by GSDMD-IR, a pore-forming protein downstream to NLRP3 inflammasome. Scale bar = 50 μm. Blue fluorescence in (A and B) is from DAPI. ( C ) Representative Western blot showing the effect of the NLRP3 inhibitor MCC950 (10 mg/kg i.p., once a day for 7 days) on the Piezo1 protein level in the bilateral ACC (top). Protein quantification results (bottom). * p -value < 0.05, ** p -value < 0.01 (two-way ANOVA). ( D ) Changes in ipsilateral paw withdrawal thresholds in sham, SNI + PBS, and SNI + MCC950 group. Significant differences in the threshold were observed in SNI + PBS rats but not SNI + MCC950 rats compared with sham rats on PO days 5, 11 and 15 ( n = 6). * p -value < 0.05 versus PO day −1 (Dunn’s multiple comparisons test) or # p -value < 0.05, ## p -value < 0.01 versus the sham group (multiple t test).

Article Snippet: Incubation with anti-Piezo1 antibody (1:100, Alomone, Jerusalem, Israel) plus either anti-Parvalbumin antibody (1:500, NOVUS, Littleton, CO, USA), anti-CaMKⅡ recombinant rabbit monoclonal antibody (1:200, HuaBio, Zhejiang, China), anti-CD68 antibody (1:200; Abcam, Cambridge, UK) or anti-NLRP3 antibody (1:100, Affinity, Cincinnati, OH, USA) was performed overnight at 4 °C.

Techniques: Inhibition, Double Staining, Double Immunofluorescence Staining, Fluorescence, Western Blot

Figure 1. Expression of Piezo1 in eMSC spheroids. (A) Immunofluorescent staining evidenced the presence of Piezo1 proteins. Shown are representative confocal slices obtained from the bottom plane (near the cover glass) and through the center of the spheroid. The schematic illustrations of focal planes used for acquisition are shown at the right from the images. Red channel—Piezo1 immunofluorescence, blue channel—cell nuclei. Note that in the focal plane through the center no Piezo1 staining is observed in the cells inside the spheroids, which is presumably due to the inability of the antibodies to penetrate inside the spheroid mass as well as the used antibodies not requiring permeabilization. No staining was observed if the primary antibodies were omitted (Supplementary Figure S1). (B) PIEZO1 mRNA was detected in spheroid lysates: the primers against PIEZO1 amplified the product of the expected size (165 bp). Original gels are shown in Supplementary Figure S2 (C) Relative mRNA expression levels of PIEZO1 in 2D and 3D eMSC cultures counted using the 2−∆∆Ct method. The qPCR data were normalized to HPRT1 and TBP gene mRNA (see Section 3). ***—significantly different, unpaired t-test, p < 0.001.

Journal: International journal of molecular sciences

Article Title: Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids.

doi: 10.3390/ijms26062474

Figure Lengend Snippet: Figure 1. Expression of Piezo1 in eMSC spheroids. (A) Immunofluorescent staining evidenced the presence of Piezo1 proteins. Shown are representative confocal slices obtained from the bottom plane (near the cover glass) and through the center of the spheroid. The schematic illustrations of focal planes used for acquisition are shown at the right from the images. Red channel—Piezo1 immunofluorescence, blue channel—cell nuclei. Note that in the focal plane through the center no Piezo1 staining is observed in the cells inside the spheroids, which is presumably due to the inability of the antibodies to penetrate inside the spheroid mass as well as the used antibodies not requiring permeabilization. No staining was observed if the primary antibodies were omitted (Supplementary Figure S1). (B) PIEZO1 mRNA was detected in spheroid lysates: the primers against PIEZO1 amplified the product of the expected size (165 bp). Original gels are shown in Supplementary Figure S2 (C) Relative mRNA expression levels of PIEZO1 in 2D and 3D eMSC cultures counted using the 2−∆∆Ct method. The qPCR data were normalized to HPRT1 and TBP gene mRNA (see Section 3). ***—significantly different, unpaired t-test, p < 0.001.

Article Snippet: Selective Piezo1 activator Yoda1 (2-(5-{[(2,6-dichlorophenyl)- methyl]sulfanyl}-1,3,4thiadiazol-2-yl) pyrazine, Tocris, UK, Cat. 5580) was dissolved in dimethylsulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) to obtain a stock solution of 10 mM.

Techniques: Expressing, Staining, Immunofluorescence, Amplification

Figure 2. Selective chemical Piezo1 agonist Yoda1 evokes Ca2+ entry in eMSC spheroids. Shown are pseudo-colored images of the representative spheroid loaded with Fluo8 Ca2+ probe demonstrating the increase of [Ca2+]i after application of 10 µM Yoda1. Ca2+ ionophore ionomycin (IM) was applied at the end of each experiment to evoke maximal Ca2+ entry (maximal Fluo8 fluorescence). The level of basal fluorescence (in 2Ca, before Yoda1 addition) and fluorescence after Yoda1 application (Y1) of each cell was normalized to the maximal Ca2+ entry (fluorescence after ionomycin, IM). Shown are normalized mean (±S.D.) fluorescence values of n = 24 cells from n = 3 independent experiments (individual spheroids). ****—significantly different, paired t-test, p < 0.0001.

Journal: International journal of molecular sciences

Article Title: Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids.

doi: 10.3390/ijms26062474

Figure Lengend Snippet: Figure 2. Selective chemical Piezo1 agonist Yoda1 evokes Ca2+ entry in eMSC spheroids. Shown are pseudo-colored images of the representative spheroid loaded with Fluo8 Ca2+ probe demonstrating the increase of [Ca2+]i after application of 10 µM Yoda1. Ca2+ ionophore ionomycin (IM) was applied at the end of each experiment to evoke maximal Ca2+ entry (maximal Fluo8 fluorescence). The level of basal fluorescence (in 2Ca, before Yoda1 addition) and fluorescence after Yoda1 application (Y1) of each cell was normalized to the maximal Ca2+ entry (fluorescence after ionomycin, IM). Shown are normalized mean (±S.D.) fluorescence values of n = 24 cells from n = 3 independent experiments (individual spheroids). ****—significantly different, paired t-test, p < 0.0001.

Article Snippet: Selective Piezo1 activator Yoda1 (2-(5-{[(2,6-dichlorophenyl)- methyl]sulfanyl}-1,3,4thiadiazol-2-yl) pyrazine, Tocris, UK, Cat. 5580) was dissolved in dimethylsulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) to obtain a stock solution of 10 mM.

Techniques: Fluorescence

Figure 3. The presence of Yoda1 in the hanging drops during eMSCs spheroid formation affects the morphological parameters of the spheroids. (A) Shown are the cells in different stages of spheroid formation at 24, 48, and 72 h in control (0.1% DMSO) and in the presence of 10 µM Yoda1. Note the dark color of the spheroids that is due to the MTT reaction, thus indicating that the cells in hanging drops were viable (see Materials and Methods for details). (B) The morphological parameters of the spheroids after 72 h. The exposure of eMSCs to Yoda1 resulted in the formation of smaller (lower area) and more irregular (less circular and more elongated) spheroids, compared to control. Shown are medians (inside the box), upper and lower quartiles (box borders), and minimal and maximal values (whiskers). The area, circularity, and aspect ratio parameters were significantly different between the groups (**** p < 0.0001, Mann–Whitney test). Total of n = 230 control and n = 98 spheroids formed with Yoda1 were analyzed.

Journal: International journal of molecular sciences

Article Title: Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids.

doi: 10.3390/ijms26062474

Figure Lengend Snippet: Figure 3. The presence of Yoda1 in the hanging drops during eMSCs spheroid formation affects the morphological parameters of the spheroids. (A) Shown are the cells in different stages of spheroid formation at 24, 48, and 72 h in control (0.1% DMSO) and in the presence of 10 µM Yoda1. Note the dark color of the spheroids that is due to the MTT reaction, thus indicating that the cells in hanging drops were viable (see Materials and Methods for details). (B) The morphological parameters of the spheroids after 72 h. The exposure of eMSCs to Yoda1 resulted in the formation of smaller (lower area) and more irregular (less circular and more elongated) spheroids, compared to control. Shown are medians (inside the box), upper and lower quartiles (box borders), and minimal and maximal values (whiskers). The area, circularity, and aspect ratio parameters were significantly different between the groups (**** p < 0.0001, Mann–Whitney test). Total of n = 230 control and n = 98 spheroids formed with Yoda1 were analyzed.

Article Snippet: Selective Piezo1 activator Yoda1 (2-(5-{[(2,6-dichlorophenyl)- methyl]sulfanyl}-1,3,4thiadiazol-2-yl) pyrazine, Tocris, UK, Cat. 5580) was dissolved in dimethylsulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) to obtain a stock solution of 10 mM.

Techniques: Control, MANN-WHITNEY

Figure 5. Yoda1-treated eMSC spheroids have significantly lower spreading rates. Shown are representative images after 2 h from spheroid seeding to the well and after 24 h from the start of the experiment. Spheroid borders are designated by the black lines, and S2 and S1 areas are shown as a merged image. The S2/S1 vs. S1 data points are plotted for control and Yoda1-treated spheroids as black and blue dots, respectively. Bar graphs showing medians with range and each point in the dataset. ****—p < 0.0001, ***—p < 0.001, significantly different, Mann–Whitney test. Total n = 78 control and n = 12 Yoda1-treated spheroids were analyzed.

Journal: International journal of molecular sciences

Article Title: Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids.

doi: 10.3390/ijms26062474

Figure Lengend Snippet: Figure 5. Yoda1-treated eMSC spheroids have significantly lower spreading rates. Shown are representative images after 2 h from spheroid seeding to the well and after 24 h from the start of the experiment. Spheroid borders are designated by the black lines, and S2 and S1 areas are shown as a merged image. The S2/S1 vs. S1 data points are plotted for control and Yoda1-treated spheroids as black and blue dots, respectively. Bar graphs showing medians with range and each point in the dataset. ****—p < 0.0001, ***—p < 0.001, significantly different, Mann–Whitney test. Total n = 78 control and n = 12 Yoda1-treated spheroids were analyzed.

Article Snippet: Selective Piezo1 activator Yoda1 (2-(5-{[(2,6-dichlorophenyl)- methyl]sulfanyl}-1,3,4thiadiazol-2-yl) pyrazine, Tocris, UK, Cat. 5580) was dissolved in dimethylsulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) to obtain a stock solution of 10 mM.

Techniques: Control, MANN-WHITNEY

Figure 6. eMSC spheroids formed in the presence of Piezo1 activator Yoda1 have lower spreading rates. Shown are representative images after 2 h from spheroid seeding to the well and after 24 h from the start of the experiment. Spheroid borders are designated by the black lines, and S2 and S1 areas are shown as a merged image. The S2/S1 vs. S1 data points are plotted for control spheroids and spheroids formed in the presence of Yoda1 as black and blue dots, respectively. Bar graphs showing medians with ranges and all experimental points in the dataset. **** significantly different, p < 0.0001, Mann–Whitney test. Total of n = 78 and n = 24 control and Yoda1-treated spheroids were analyzed, respectively.

Journal: International journal of molecular sciences

Article Title: Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids.

doi: 10.3390/ijms26062474

Figure Lengend Snippet: Figure 6. eMSC spheroids formed in the presence of Piezo1 activator Yoda1 have lower spreading rates. Shown are representative images after 2 h from spheroid seeding to the well and after 24 h from the start of the experiment. Spheroid borders are designated by the black lines, and S2 and S1 areas are shown as a merged image. The S2/S1 vs. S1 data points are plotted for control spheroids and spheroids formed in the presence of Yoda1 as black and blue dots, respectively. Bar graphs showing medians with ranges and all experimental points in the dataset. **** significantly different, p < 0.0001, Mann–Whitney test. Total of n = 78 and n = 24 control and Yoda1-treated spheroids were analyzed, respectively.

Article Snippet: Selective Piezo1 activator Yoda1 (2-(5-{[(2,6-dichlorophenyl)- methyl]sulfanyl}-1,3,4thiadiazol-2-yl) pyrazine, Tocris, UK, Cat. 5580) was dissolved in dimethylsulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) to obtain a stock solution of 10 mM.

Techniques: Control, MANN-WHITNEY

Figure 7. eMSC spheroid spreading rates on plastic and glass surfaces is dependent on Piezo1 activity. On the left, the S2/S1 vs. S1 data points are plotted for spheroids formed under control conditions (control) and in the presence of Yoda1 (Y1) spread on plastic (plastic control and Y1, black dots) and glass (glass control and Y1, green dots). Note almost similar distributions of experimental values for the spheroids formed with Yoda1 and spread on glass and plastic (plastic Y1 and glass Y1). Yoda1-formed spheroids were divided into two experimental groups, based on the median size of the spheroid area (S1). On the right, corresponding quantifications of S2/S1 rates. Bar graphs showing medians with ranges and all experimental points in the dataset. ns—non-significantly different, * p < 0.05, ** p < 0.01. Mann–Whitney test. Total number of control spheroids spread on plastic (n = 78) or glass (n = 30); Yoda1-treated spheroids spread on plastic (n = 24) or glass (n = 22).

Journal: International journal of molecular sciences

Article Title: Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids.

doi: 10.3390/ijms26062474

Figure Lengend Snippet: Figure 7. eMSC spheroid spreading rates on plastic and glass surfaces is dependent on Piezo1 activity. On the left, the S2/S1 vs. S1 data points are plotted for spheroids formed under control conditions (control) and in the presence of Yoda1 (Y1) spread on plastic (plastic control and Y1, black dots) and glass (glass control and Y1, green dots). Note almost similar distributions of experimental values for the spheroids formed with Yoda1 and spread on glass and plastic (plastic Y1 and glass Y1). Yoda1-formed spheroids were divided into two experimental groups, based on the median size of the spheroid area (S1). On the right, corresponding quantifications of S2/S1 rates. Bar graphs showing medians with ranges and all experimental points in the dataset. ns—non-significantly different, * p < 0.05, ** p < 0.01. Mann–Whitney test. Total number of control spheroids spread on plastic (n = 78) or glass (n = 30); Yoda1-treated spheroids spread on plastic (n = 24) or glass (n = 22).

Article Snippet: Selective Piezo1 activator Yoda1 (2-(5-{[(2,6-dichlorophenyl)- methyl]sulfanyl}-1,3,4thiadiazol-2-yl) pyrazine, Tocris, UK, Cat. 5580) was dissolved in dimethylsulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) to obtain a stock solution of 10 mM.

Techniques: Activity Assay, Control, MANN-WHITNEY

Figure 9. Experimental protocols used in the spheroid assays. Spheroids were formed from cell suspension under control conditions (0.1% DMSO) (A) and (B) in the presence of 10 µM Yoda1. Then, the control spheroids were plated into wells in 0.1% DMSO (C) or in 10 µM Yoda1 (D). Spheroids formed in the presence of Yoda1 were plated in 0.1% DMSO (E) (Yoda1 was washed out).

Journal: International journal of molecular sciences

Article Title: Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids.

doi: 10.3390/ijms26062474

Figure Lengend Snippet: Figure 9. Experimental protocols used in the spheroid assays. Spheroids were formed from cell suspension under control conditions (0.1% DMSO) (A) and (B) in the presence of 10 µM Yoda1. Then, the control spheroids were plated into wells in 0.1% DMSO (C) or in 10 µM Yoda1 (D). Spheroids formed in the presence of Yoda1 were plated in 0.1% DMSO (E) (Yoda1 was washed out).

Article Snippet: Selective Piezo1 activator Yoda1 (2-(5-{[(2,6-dichlorophenyl)- methyl]sulfanyl}-1,3,4thiadiazol-2-yl) pyrazine, Tocris, UK, Cat. 5580) was dissolved in dimethylsulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) to obtain a stock solution of 10 mM.

Techniques: Suspension, Control

Modulation of neurite elongation by PIEZO1 in MagNAV-loaded hiPSC-derived RGCs. (A) Immunofluorescence staining showing PIEZO1 (red) expression in TUJ1-positive RGCs (green), with nuclei labeled by DAPI (blue), confirming localization in both soma and proximal neurites. The enlarged image in the red box shows the localization of PIEZO1 in cell bodies and neurites. Scale bar = 50μm. (B, C) CCK-8 assay results showing the cytocompatibility of Yoda1 (B) and Dooku1 (C) at increasing concentrations. Yoda1 showed cytotoxicity above 20 μM, while Dooku1 maintained acceptable viability up to 10 μM. (D) Representative brightfield images of RGCs following treatment with 10 μM Yoda1 or Dooku1, showing no obvious morphological changes. (E) Quantification of neurite length under different treatment conditions. Dooku1 significantly enhanced neurite outgrowth, whereas Yoda1 had no significant effect relative to control. Data are presented as mean ± SEM. ∗p < 0.05.

Journal: Materials Today Bio

Article Title: Magnetically guided neurite outgrowth modulated by PIEZO1 in hiPSC-derived retinal ganglion cells

doi: 10.1016/j.mtbio.2025.102446

Figure Lengend Snippet: Modulation of neurite elongation by PIEZO1 in MagNAV-loaded hiPSC-derived RGCs. (A) Immunofluorescence staining showing PIEZO1 (red) expression in TUJ1-positive RGCs (green), with nuclei labeled by DAPI (blue), confirming localization in both soma and proximal neurites. The enlarged image in the red box shows the localization of PIEZO1 in cell bodies and neurites. Scale bar = 50μm. (B, C) CCK-8 assay results showing the cytocompatibility of Yoda1 (B) and Dooku1 (C) at increasing concentrations. Yoda1 showed cytotoxicity above 20 μM, while Dooku1 maintained acceptable viability up to 10 μM. (D) Representative brightfield images of RGCs following treatment with 10 μM Yoda1 or Dooku1, showing no obvious morphological changes. (E) Quantification of neurite length under different treatment conditions. Dooku1 significantly enhanced neurite outgrowth, whereas Yoda1 had no significant effect relative to control. Data are presented as mean ± SEM. ∗p < 0.05.

Article Snippet: hiPSC-RGC cells were transfected with a lentiviral vector expressing a shRNA targeting human PIEZO1 (sc-93227-V, Santa Cruz Biotechnology).

Techniques: Derivative Assay, Immunofluorescence, Staining, Expressing, Labeling, CCK-8 Assay, Control

Synergistic effects of PIEZO1 modulation and magnetic force on neurite elongation in MagNAV-loaded hiPSC-derived RGCs. (A) Experimental workflow showing hiPSC-RGCs preloaded with MagNAVs and subjected to treatment with PIEZO1 agonist (Yoda1) or antagonist (Dooku1), with or without exposure to an external magnetic field (MF). (B) Quantification of neurite length under different treatment combinations. Yoda1 alone did not significantly affect neurite growth compared to control. Yoda1 combined with MagNAV + MF increased neurite length, but this effect was comparable to MagNAV + MF alone. Dooku1 alone and MagNAV + MF alone both significantly enhanced neurite outgrowth. Notably, the combination of Dooku1 and MagNAV + MF resulted in the greatest neurite elongation, suggesting a synergistic interaction between PIEZO1 inhibition and magnetic stimulation. Data are shown as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01. (C) Western blot validating PIEZO1 knockdown 48 h after transduction with PIEZO1 shRNA lentivirus versus non-targeting control shRNA; GAPDH as loading control. (D) Neurite length per cell (mean ± SEM; dots = biological replicates). Two-way ANOVA with Sidak correction; ∗p < 0.05.

Journal: Materials Today Bio

Article Title: Magnetically guided neurite outgrowth modulated by PIEZO1 in hiPSC-derived retinal ganglion cells

doi: 10.1016/j.mtbio.2025.102446

Figure Lengend Snippet: Synergistic effects of PIEZO1 modulation and magnetic force on neurite elongation in MagNAV-loaded hiPSC-derived RGCs. (A) Experimental workflow showing hiPSC-RGCs preloaded with MagNAVs and subjected to treatment with PIEZO1 agonist (Yoda1) or antagonist (Dooku1), with or without exposure to an external magnetic field (MF). (B) Quantification of neurite length under different treatment combinations. Yoda1 alone did not significantly affect neurite growth compared to control. Yoda1 combined with MagNAV + MF increased neurite length, but this effect was comparable to MagNAV + MF alone. Dooku1 alone and MagNAV + MF alone both significantly enhanced neurite outgrowth. Notably, the combination of Dooku1 and MagNAV + MF resulted in the greatest neurite elongation, suggesting a synergistic interaction between PIEZO1 inhibition and magnetic stimulation. Data are shown as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01. (C) Western blot validating PIEZO1 knockdown 48 h after transduction with PIEZO1 shRNA lentivirus versus non-targeting control shRNA; GAPDH as loading control. (D) Neurite length per cell (mean ± SEM; dots = biological replicates). Two-way ANOVA with Sidak correction; ∗p < 0.05.

Article Snippet: hiPSC-RGC cells were transfected with a lentiviral vector expressing a shRNA targeting human PIEZO1 (sc-93227-V, Santa Cruz Biotechnology).

Techniques: Derivative Assay, Control, Inhibition, Western Blot, Knockdown, Transduction, shRNA

Compartment-specific regulation of spontaneous calcium transients in hiPSC-derived RGCs by PIEZO1 activity and magnetic force. (A, B) Representative calcium traces recorded via two-photon microscopy from the soma (A) and neurites (B) of hiPSC-RGCs treated with Yoda1, Dooku1, and/or MF following MagNAV internalization. (C) Comparison of peak calcium transient amplitudes between soma and neurites from paired recordings within the same cells. Most cells exhibited higher transient amplitudes in neurites than soma, though some showed the inverse. (D) Quantification of spontaneous calcium transient frequency in the soma. Yoda1 significantly increased transient frequency, while Dooku1 significantly decreased it. MagNAV + MF alone had no significant effect, but a trend toward further suppression was observed when combined with Dooku1. (E) Quantification of spontaneous calcium transient frequency in the neurites. Yoda1 did not significantly affect activity, whereas MagNAV + MF significantly suppressed neuritic calcium transients. Dooku1 addition did not further reduce activity beyond MF alone. Data represent mean ± SEM. ∗p < 0.05, ∗∗p < 0.01. (F) Representative immunofluorescence images of hiPSC-RGCs cultured with MagNAVs in the absence (top) or presence (bottom) of MF. Cells were stained for PIEZO1 (red), F-actin/phalloidin (green), and nuclei (blue). Without magnetic stimulation, PIEZO1 distribution remained diffuse along neurites. Scale bar = 50 μ m. (G) Quantification of the PIEZO1 neurite-to-soma fluorescence intensity ratio. Data are mean ± SEM. ∗∗∗∗p < 0.0001.

Journal: Materials Today Bio

Article Title: Magnetically guided neurite outgrowth modulated by PIEZO1 in hiPSC-derived retinal ganglion cells

doi: 10.1016/j.mtbio.2025.102446

Figure Lengend Snippet: Compartment-specific regulation of spontaneous calcium transients in hiPSC-derived RGCs by PIEZO1 activity and magnetic force. (A, B) Representative calcium traces recorded via two-photon microscopy from the soma (A) and neurites (B) of hiPSC-RGCs treated with Yoda1, Dooku1, and/or MF following MagNAV internalization. (C) Comparison of peak calcium transient amplitudes between soma and neurites from paired recordings within the same cells. Most cells exhibited higher transient amplitudes in neurites than soma, though some showed the inverse. (D) Quantification of spontaneous calcium transient frequency in the soma. Yoda1 significantly increased transient frequency, while Dooku1 significantly decreased it. MagNAV + MF alone had no significant effect, but a trend toward further suppression was observed when combined with Dooku1. (E) Quantification of spontaneous calcium transient frequency in the neurites. Yoda1 did not significantly affect activity, whereas MagNAV + MF significantly suppressed neuritic calcium transients. Dooku1 addition did not further reduce activity beyond MF alone. Data represent mean ± SEM. ∗p < 0.05, ∗∗p < 0.01. (F) Representative immunofluorescence images of hiPSC-RGCs cultured with MagNAVs in the absence (top) or presence (bottom) of MF. Cells were stained for PIEZO1 (red), F-actin/phalloidin (green), and nuclei (blue). Without magnetic stimulation, PIEZO1 distribution remained diffuse along neurites. Scale bar = 50 μ m. (G) Quantification of the PIEZO1 neurite-to-soma fluorescence intensity ratio. Data are mean ± SEM. ∗∗∗∗p < 0.0001.

Article Snippet: hiPSC-RGC cells were transfected with a lentiviral vector expressing a shRNA targeting human PIEZO1 (sc-93227-V, Santa Cruz Biotechnology).

Techniques: Derivative Assay, Activity Assay, Microscopy, Comparison, Immunofluorescence, Cell Culture, Staining, Fluorescence

Ischemia-reperfusion injury induced an upregulation of Piezo1. WT male mice and Piezo1 td/Tdt male mice underwent the I/R injury (30min/4h). NMCMs were extracted from both WT and Piezo1 td/Tdt mice and subjected to 8-h hypoxia and 1-h reoxygenation. (A) Western blot analysis and quantitative data of Piezo1 expression in the infarcted and non-infarcted regions of the hearts. (B) Relative expression levels of mRNA for Piezo1 in the infarcted area or non-infarcted area. (C) Representative immunohistochemical staining images and statistical data of Piezo1 expression in the infarcted and non-infarcted regions of the hearts. Scale bar, 1 mm. Detailed photographs are displayed below. Scale bar, 100 μm. (D) Representative images of Piezo1 stained with antibodies against RFP (red). Scale bar, 30 μm. (E) Western blot analysis and quantitative data of Piezo1 expression in NMCMs in Ctrl or H/R groups. (F) Relative expression levels of mRNA for Piezo1 in NMCMs in Ctrl or H/R groups. (G) Representative images of Piezo1 in NMCMs from Piezo1 td/Tdt mice. Scale bar, 25 μm. n = 4 for Western blot analysis, n = 6 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Journal: Redox Biology

Article Title: Cardiomyocyte-specific Piezo1 deficiency mitigates ischemia-reperfusion injury by preserving mitochondrial homeostasis

doi: 10.1016/j.redox.2024.103471

Figure Lengend Snippet: Ischemia-reperfusion injury induced an upregulation of Piezo1. WT male mice and Piezo1 td/Tdt male mice underwent the I/R injury (30min/4h). NMCMs were extracted from both WT and Piezo1 td/Tdt mice and subjected to 8-h hypoxia and 1-h reoxygenation. (A) Western blot analysis and quantitative data of Piezo1 expression in the infarcted and non-infarcted regions of the hearts. (B) Relative expression levels of mRNA for Piezo1 in the infarcted area or non-infarcted area. (C) Representative immunohistochemical staining images and statistical data of Piezo1 expression in the infarcted and non-infarcted regions of the hearts. Scale bar, 1 mm. Detailed photographs are displayed below. Scale bar, 100 μm. (D) Representative images of Piezo1 stained with antibodies against RFP (red). Scale bar, 30 μm. (E) Western blot analysis and quantitative data of Piezo1 expression in NMCMs in Ctrl or H/R groups. (F) Relative expression levels of mRNA for Piezo1 in NMCMs in Ctrl or H/R groups. (G) Representative images of Piezo1 in NMCMs from Piezo1 td/Tdt mice. Scale bar, 25 μm. n = 4 for Western blot analysis, n = 6 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Article Snippet: During H/R injury, we treated Piezo1 fl/fl group cells with Mdivi-1 (5 μM, MCE, USA) to inhibit mitochondrial fission [ , ].

Techniques: Western Blot, Expressing, Immunohistochemical staining, Staining

Myocardial Piezo1 knockout alleviated cardiac I/R injury. (A) Representative Evans Blue & TTC staining images of infarct size (IF) and area at risk (AAR) in hearts from Piezo1 fl/fl and Piezo1 △Myh6 mice subjected to I/R(30min/24h) or sham. Scale bar, 1 mm. (B–C) Representative images ang statistical data of TUNEL staining in Piezo1 fl/fl and Piezo1 △Myh6 mice with sham or I/R (30min/24h). Scale bar, 25 μm. (D) Serum LDH concentrations in each group of mice. (E) Representative images and statistical data (G) for live (green) dead (red) staining. Scale bar, 75 μm. (F) Representative images and statistical data (H) of TUNEL positive cells in NMCMs. Scale bar, 75 μm (I) LDH levels in NMCMs from each group. (J) NMCMs viability assayed by CCK8. (K – L) Cardiac gross morphology and the ratio of heart weight to body weight in mice suffering from heart failure. Scale bar, 2 mm. (M – Q) Representative M-mode echocardiograms (M) , statistical data of EF, FS, LVIDd and LVIDs (N – Q) for Mice suffering from heart failure. n = 5 for each group. Data are presented as mean ± SEM. ∗P < 0.05.

Journal: Redox Biology

Article Title: Cardiomyocyte-specific Piezo1 deficiency mitigates ischemia-reperfusion injury by preserving mitochondrial homeostasis

doi: 10.1016/j.redox.2024.103471

Figure Lengend Snippet: Myocardial Piezo1 knockout alleviated cardiac I/R injury. (A) Representative Evans Blue & TTC staining images of infarct size (IF) and area at risk (AAR) in hearts from Piezo1 fl/fl and Piezo1 △Myh6 mice subjected to I/R(30min/24h) or sham. Scale bar, 1 mm. (B–C) Representative images ang statistical data of TUNEL staining in Piezo1 fl/fl and Piezo1 △Myh6 mice with sham or I/R (30min/24h). Scale bar, 25 μm. (D) Serum LDH concentrations in each group of mice. (E) Representative images and statistical data (G) for live (green) dead (red) staining. Scale bar, 75 μm. (F) Representative images and statistical data (H) of TUNEL positive cells in NMCMs. Scale bar, 75 μm (I) LDH levels in NMCMs from each group. (J) NMCMs viability assayed by CCK8. (K – L) Cardiac gross morphology and the ratio of heart weight to body weight in mice suffering from heart failure. Scale bar, 2 mm. (M – Q) Representative M-mode echocardiograms (M) , statistical data of EF, FS, LVIDd and LVIDs (N – Q) for Mice suffering from heart failure. n = 5 for each group. Data are presented as mean ± SEM. ∗P < 0.05.

Article Snippet: During H/R injury, we treated Piezo1 fl/fl group cells with Mdivi-1 (5 μM, MCE, USA) to inhibit mitochondrial fission [ , ].

Techniques: Knock-Out, Staining, TUNEL Assay

Myocardial Piezo1 knockout reduced I/R-induced cardiac inflammation. (A) Representative H&E staining images of heart. Scale bar, 100 μm. Detailed photographs are displayed below. Scale bar, 20 μm. (B – E) Representative immunofluorescence staining images and statistical data of the MPO positive cells (B&E) , F4/80 positive cells (C&D). Scale bar, 25 μm. (F – G) Representative dot plots and statistical data from flow cytometry analysis for assessing leukocyte percentage (FVD − CD45 + ) and neutrophils percentage (FVD − CD45 + CD11b + Ly6G + ). (H) Relative expression levels of IL1β , IL6 , TNF-α , MCP-1 , MMP9 mRNA of hearts. The heatmap displays the logarithmic values of gene expression levels. (I – L) Relative expression levels of mRNA for IL1β , IL6 , TNF-α , MCP-1 of NMCMs. n = 4 for flow cytometry results, n = 6 for heatmap, and n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Journal: Redox Biology

Article Title: Cardiomyocyte-specific Piezo1 deficiency mitigates ischemia-reperfusion injury by preserving mitochondrial homeostasis

doi: 10.1016/j.redox.2024.103471

Figure Lengend Snippet: Myocardial Piezo1 knockout reduced I/R-induced cardiac inflammation. (A) Representative H&E staining images of heart. Scale bar, 100 μm. Detailed photographs are displayed below. Scale bar, 20 μm. (B – E) Representative immunofluorescence staining images and statistical data of the MPO positive cells (B&E) , F4/80 positive cells (C&D). Scale bar, 25 μm. (F – G) Representative dot plots and statistical data from flow cytometry analysis for assessing leukocyte percentage (FVD − CD45 + ) and neutrophils percentage (FVD − CD45 + CD11b + Ly6G + ). (H) Relative expression levels of IL1β , IL6 , TNF-α , MCP-1 , MMP9 mRNA of hearts. The heatmap displays the logarithmic values of gene expression levels. (I – L) Relative expression levels of mRNA for IL1β , IL6 , TNF-α , MCP-1 of NMCMs. n = 4 for flow cytometry results, n = 6 for heatmap, and n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Article Snippet: During H/R injury, we treated Piezo1 fl/fl group cells with Mdivi-1 (5 μM, MCE, USA) to inhibit mitochondrial fission [ , ].

Techniques: Knock-Out, Staining, Immunofluorescence, Flow Cytometry, Expressing, Gene Expression

Piezo1 deficiency balanced mitochondrial dynamics in H/R treated NMCMs. (A) Representative immunofluorescence staining images and statistical data of mitochondrial lentgh. Scale bar, 25 μm. Detailed photographs are displayed below. Scale bar, 5 μm. (B) The co-localization and statistical data of Drp1 and mitochondria. Scale bar, 25 μm. Detailed photographs are displayed below. Scale bar, 5 μm. (C) Western blot analysis and quantitative data of Drp1, p -Drp1(S616), p -Drp1(S637), Fis1, Mff, OPA1, Mfn1 and Mfn2 in NMCMs. (D) Relative expression levels of mRNA for Drp1 , Mff , Fis1 , Mfn1 , Mfn2 and OPA1 of hearts. The heatmap displays the logarithmic values of mRNA expression. n = 4 for Western blot analysis, n = 6 for heatmap, and n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Journal: Redox Biology

Article Title: Cardiomyocyte-specific Piezo1 deficiency mitigates ischemia-reperfusion injury by preserving mitochondrial homeostasis

doi: 10.1016/j.redox.2024.103471

Figure Lengend Snippet: Piezo1 deficiency balanced mitochondrial dynamics in H/R treated NMCMs. (A) Representative immunofluorescence staining images and statistical data of mitochondrial lentgh. Scale bar, 25 μm. Detailed photographs are displayed below. Scale bar, 5 μm. (B) The co-localization and statistical data of Drp1 and mitochondria. Scale bar, 25 μm. Detailed photographs are displayed below. Scale bar, 5 μm. (C) Western blot analysis and quantitative data of Drp1, p -Drp1(S616), p -Drp1(S637), Fis1, Mff, OPA1, Mfn1 and Mfn2 in NMCMs. (D) Relative expression levels of mRNA for Drp1 , Mff , Fis1 , Mfn1 , Mfn2 and OPA1 of hearts. The heatmap displays the logarithmic values of mRNA expression. n = 4 for Western blot analysis, n = 6 for heatmap, and n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Article Snippet: During H/R injury, we treated Piezo1 fl/fl group cells with Mdivi-1 (5 μM, MCE, USA) to inhibit mitochondrial fission [ , ].

Techniques: Immunofluorescence, Staining, Western Blot, Expressing

Piezo1 deletion inhibits mitochondrial fission, to protect NMCMs from reoxygenation-induced dysfunction. (A–C) Representative images of cellular ROS and mitochondrial ROS along with their quantitative data. Scale bar, 100 μm. (D – E) Representative images and statistical data of MMP in NMCMs. Scale bar, 75 μm. (F – G) Western blot analysis and statistical data of the protein expression of Mn-SOD in NMCMs. (H) Quantitative analysis of ATP levels of NMCMs. n = 4 for Western blot analysis, n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Journal: Redox Biology

Article Title: Cardiomyocyte-specific Piezo1 deficiency mitigates ischemia-reperfusion injury by preserving mitochondrial homeostasis

doi: 10.1016/j.redox.2024.103471

Figure Lengend Snippet: Piezo1 deletion inhibits mitochondrial fission, to protect NMCMs from reoxygenation-induced dysfunction. (A–C) Representative images of cellular ROS and mitochondrial ROS along with their quantitative data. Scale bar, 100 μm. (D – E) Representative images and statistical data of MMP in NMCMs. Scale bar, 75 μm. (F – G) Western blot analysis and statistical data of the protein expression of Mn-SOD in NMCMs. (H) Quantitative analysis of ATP levels of NMCMs. n = 4 for Western blot analysis, n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Article Snippet: During H/R injury, we treated Piezo1 fl/fl group cells with Mdivi-1 (5 μM, MCE, USA) to inhibit mitochondrial fission [ , ].

Techniques: Western Blot, Expressing

Myocardial mitochondrial dynamics balance is regulated by Piezo1/Ca 2+ /Calpain axis. (A–C) Representative photographs and statistical data of [Ca 2+ ] i and [Ca 2+ ] m . Scale bars, 25 μm. (D) Calpain activity in heart tissues in each group of mice. (E) Measurements of calpain activity in each group of NMCMs. (F) Measurement of calpain activity in NMCMs treated with H/R with or without PD150606. (G) Representative immunofluorescence staining images of mitochondrial length of NMCMs treated with H/R with or without PD150606. Scale bar, 10 μm. Detailed photographs are displayed below. Scale bar, 2 μm. (H) Western blot analysis of Drp1, p -Drp1 (S616), p -Drp1 (S637), OPA1, Mfn1 and Mfn2 expression in NMCMs. (I) The co-localization of Drp1 and mitochondria. (J) Representative TUNEL staining images of NMCMs. Scale bar, 75 μm. (K) Representative photographs for live (green) dead (red) staining. Scale bar, 75 μm. n = 4 for Western blot analysis, and n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Journal: Redox Biology

Article Title: Cardiomyocyte-specific Piezo1 deficiency mitigates ischemia-reperfusion injury by preserving mitochondrial homeostasis

doi: 10.1016/j.redox.2024.103471

Figure Lengend Snippet: Myocardial mitochondrial dynamics balance is regulated by Piezo1/Ca 2+ /Calpain axis. (A–C) Representative photographs and statistical data of [Ca 2+ ] i and [Ca 2+ ] m . Scale bars, 25 μm. (D) Calpain activity in heart tissues in each group of mice. (E) Measurements of calpain activity in each group of NMCMs. (F) Measurement of calpain activity in NMCMs treated with H/R with or without PD150606. (G) Representative immunofluorescence staining images of mitochondrial length of NMCMs treated with H/R with or without PD150606. Scale bar, 10 μm. Detailed photographs are displayed below. Scale bar, 2 μm. (H) Western blot analysis of Drp1, p -Drp1 (S616), p -Drp1 (S637), OPA1, Mfn1 and Mfn2 expression in NMCMs. (I) The co-localization of Drp1 and mitochondria. (J) Representative TUNEL staining images of NMCMs. Scale bar, 75 μm. (K) Representative photographs for live (green) dead (red) staining. Scale bar, 75 μm. n = 4 for Western blot analysis, and n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Article Snippet: During H/R injury, we treated Piezo1 fl/fl group cells with Mdivi-1 (5 μM, MCE, USA) to inhibit mitochondrial fission [ , ].

Techniques: Activity Assay, Immunofluorescence, Staining, Western Blot, Expressing, TUNEL Assay

Tamoxifen-induced Piezo1 depletion in myocardial cells alleviated I/R injury. (A) Representative Evans Blue & TTC staining images of hearts from Piezo1 △MCM and Piezo1 fl/fl mice subjected to I/R (30min/24h) or sham. Scale bar, 1 mm. (B–C) Representative photomicrographs and quantitative data of TUNEL positive cells in Piezo1 fl/fl and Piezo1 △MCM mice with sham or I/R (30min/24h). Scale bar, 25 μm. (D) Serum LDH concentrations in mice. (E) Representative H&E staining photographs of hearts. Scale bar, 100 μm. Enlarged images are shown at the bottom. Scale bar, 20 μm. (F–I) Representative immunofluorescence staining images of the MPO positive cells and F4/80 positive cells along with their quantitative data. Scale bar, 25 μm. (J) Relative mRNA expression levels of IL1β , IL6 , TNF-α , MCP-1 , MMP9 in hearts. The heatmap displays the logarithmic values of gene expression levels. n = 6 for heatmap, and n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Journal: Redox Biology

Article Title: Cardiomyocyte-specific Piezo1 deficiency mitigates ischemia-reperfusion injury by preserving mitochondrial homeostasis

doi: 10.1016/j.redox.2024.103471

Figure Lengend Snippet: Tamoxifen-induced Piezo1 depletion in myocardial cells alleviated I/R injury. (A) Representative Evans Blue & TTC staining images of hearts from Piezo1 △MCM and Piezo1 fl/fl mice subjected to I/R (30min/24h) or sham. Scale bar, 1 mm. (B–C) Representative photomicrographs and quantitative data of TUNEL positive cells in Piezo1 fl/fl and Piezo1 △MCM mice with sham or I/R (30min/24h). Scale bar, 25 μm. (D) Serum LDH concentrations in mice. (E) Representative H&E staining photographs of hearts. Scale bar, 100 μm. Enlarged images are shown at the bottom. Scale bar, 20 μm. (F–I) Representative immunofluorescence staining images of the MPO positive cells and F4/80 positive cells along with their quantitative data. Scale bar, 25 μm. (J) Relative mRNA expression levels of IL1β , IL6 , TNF-α , MCP-1 , MMP9 in hearts. The heatmap displays the logarithmic values of gene expression levels. n = 6 for heatmap, and n = 5 for other results. Data are presented as mean ± SEM. ∗P < 0.05.

Article Snippet: During H/R injury, we treated Piezo1 fl/fl group cells with Mdivi-1 (5 μM, MCE, USA) to inhibit mitochondrial fission [ , ].

Techniques: Staining, TUNEL Assay, Immunofluorescence, Expressing, Gene Expression

Graphic illustration on Piezo1 Activation Under I/R Promotes Mitochondrial Fission, Oxidative Stress, and Inflammation via Calpain, Exacerbating I/R Injury.

Journal: Redox Biology

Article Title: Cardiomyocyte-specific Piezo1 deficiency mitigates ischemia-reperfusion injury by preserving mitochondrial homeostasis

doi: 10.1016/j.redox.2024.103471

Figure Lengend Snippet: Graphic illustration on Piezo1 Activation Under I/R Promotes Mitochondrial Fission, Oxidative Stress, and Inflammation via Calpain, Exacerbating I/R Injury.

Article Snippet: During H/R injury, we treated Piezo1 fl/fl group cells with Mdivi-1 (5 μM, MCE, USA) to inhibit mitochondrial fission [ , ].

Techniques: Activation Assay

Fig. 2 Histological analysis and the expression of Piezo1 and type II collage in human nucleus pulposus tissues. A, B Hematoxylin and eosin (H&E) staining in human NP tissues of the control or the IVDD group (200×). C, D Piezo1 immunostaining in human NP tissues of the control or the IVDD group (100×). E The percentage of Piezo1 positive cells to all cells in the field (%). F, G Type II collage immunostaining in human NP tissues of the control or the IVDD group (100×). H The percentage of Col II positive cells to all cells in the field (%). *p < 0.05

Journal: Arthritis research & therapy

Article Title: Excessive mechanical stress-induced intervertebral disc degeneration is related to Piezo1 overexpression triggering the imbalance of autophagy/apoptosis in human nucleus pulpous.

doi: 10.1186/s13075-022-02804-y

Figure Lengend Snippet: Fig. 2 Histological analysis and the expression of Piezo1 and type II collage in human nucleus pulposus tissues. A, B Hematoxylin and eosin (H&E) staining in human NP tissues of the control or the IVDD group (200×). C, D Piezo1 immunostaining in human NP tissues of the control or the IVDD group (100×). E The percentage of Piezo1 positive cells to all cells in the field (%). F, G Type II collage immunostaining in human NP tissues of the control or the IVDD group (100×). H The percentage of Col II positive cells to all cells in the field (%). *p < 0.05

Article Snippet: The blots were probed overnight with primary antibodies against Piezo1 (Novus Biologicals, USA), collagen II, aggrecan (from Abcam, USA), p53, p16, LC3, Beclin-1, p62, Bax, Bcl-2, and β-actin (from Cell Signaling Technology, USA), followed by incubation with fluorescently-labeled secondary antibody (LI-COR, USA).

Techniques: Expressing, Staining, Control, Immunostaining

Fig. 3 Piezo1 expression and cell function of human nucleus pulposus cells under mechanical stress. A NP cells received various mechanical stress treatment. Cell viability was measured by MTT assay. B Gene expression of Piezo1 was measured by real-time PCR. C, D Western blot analysis of Piezo1’s protein level. Total β-actin served as loading controls. E, F Immunofluorescence staining analysis of Piezo1 expression. Relative fluorescent levels of Piezo1 were measured by Image J software. G Concentrations of pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 in supernatants were measured by ELISA. H Mitochondrial membrane potential was measured by JC-1 probe and flow cytometer. I OCR of cells were measured by Seahorse XFe96 Extracellular Flux Analyzer at basal conditions and with serial administration of oligomycin, FCCP and rotenone. J–L Gene and protein expressions of P53 and P16. Total β-actin served as loading controls. *p < 0.05. All experiments were repeated at least three times

Journal: Arthritis research & therapy

Article Title: Excessive mechanical stress-induced intervertebral disc degeneration is related to Piezo1 overexpression triggering the imbalance of autophagy/apoptosis in human nucleus pulpous.

doi: 10.1186/s13075-022-02804-y

Figure Lengend Snippet: Fig. 3 Piezo1 expression and cell function of human nucleus pulposus cells under mechanical stress. A NP cells received various mechanical stress treatment. Cell viability was measured by MTT assay. B Gene expression of Piezo1 was measured by real-time PCR. C, D Western blot analysis of Piezo1’s protein level. Total β-actin served as loading controls. E, F Immunofluorescence staining analysis of Piezo1 expression. Relative fluorescent levels of Piezo1 were measured by Image J software. G Concentrations of pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 in supernatants were measured by ELISA. H Mitochondrial membrane potential was measured by JC-1 probe and flow cytometer. I OCR of cells were measured by Seahorse XFe96 Extracellular Flux Analyzer at basal conditions and with serial administration of oligomycin, FCCP and rotenone. J–L Gene and protein expressions of P53 and P16. Total β-actin served as loading controls. *p < 0.05. All experiments were repeated at least three times

Article Snippet: The blots were probed overnight with primary antibodies against Piezo1 (Novus Biologicals, USA), collagen II, aggrecan (from Abcam, USA), p53, p16, LC3, Beclin-1, p62, Bax, Bcl-2, and β-actin (from Cell Signaling Technology, USA), followed by incubation with fluorescently-labeled secondary antibody (LI-COR, USA).

Techniques: Expressing, Cell Function Assay, MTT Assay, Gene Expression, Real-time Polymerase Chain Reaction, Western Blot, Immunofluorescence, Staining, Software, Enzyme-linked Immunosorbent Assay, Membrane, Flow Cytometry

Fig. 4 Autophagy and apoptosis related protein expressions in human nucleus pulposus cells after mechanical stress treatment. A Concentrations of pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 in supernatants after mechanical stress treatment with/without administration of Piezo1 inhibitor GsMTx4. B Mitochondrial membrane potential was measured after mechanical stress treatment with/without GsMTx4. C–E Western blot analysis of protein levels of Col II, Aggrecan, LC3 II, LC3 I, Beclin-1, P62. Total β-actin served as loading controls. F, G Immunofluorescence staining analysis of LC3 expression after mechanical stress treatment with or without GsMTx4, relative fluorescent levels of LC3 were measured by Image J software. H, I Western blot analysis of Bax and Bcl-2’s protein levels. Total β-actin served as loading controls. J Cell apoptosis was assessed by flow cytometer with Annexin V-FITC/PI apoptosis detection kit. *p < 0.05. Data were obtained from three independent experiments

Journal: Arthritis research & therapy

Article Title: Excessive mechanical stress-induced intervertebral disc degeneration is related to Piezo1 overexpression triggering the imbalance of autophagy/apoptosis in human nucleus pulpous.

doi: 10.1186/s13075-022-02804-y

Figure Lengend Snippet: Fig. 4 Autophagy and apoptosis related protein expressions in human nucleus pulposus cells after mechanical stress treatment. A Concentrations of pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 in supernatants after mechanical stress treatment with/without administration of Piezo1 inhibitor GsMTx4. B Mitochondrial membrane potential was measured after mechanical stress treatment with/without GsMTx4. C–E Western blot analysis of protein levels of Col II, Aggrecan, LC3 II, LC3 I, Beclin-1, P62. Total β-actin served as loading controls. F, G Immunofluorescence staining analysis of LC3 expression after mechanical stress treatment with or without GsMTx4, relative fluorescent levels of LC3 were measured by Image J software. H, I Western blot analysis of Bax and Bcl-2’s protein levels. Total β-actin served as loading controls. J Cell apoptosis was assessed by flow cytometer with Annexin V-FITC/PI apoptosis detection kit. *p < 0.05. Data were obtained from three independent experiments

Article Snippet: The blots were probed overnight with primary antibodies against Piezo1 (Novus Biologicals, USA), collagen II, aggrecan (from Abcam, USA), p53, p16, LC3, Beclin-1, p62, Bax, Bcl-2, and β-actin (from Cell Signaling Technology, USA), followed by incubation with fluorescently-labeled secondary antibody (LI-COR, USA).

Techniques: Membrane, Western Blot, Immunofluorescence, Staining, Expressing, Software, Flow Cytometry

Fig. 5 Excessive mechanical stress stimulates mechanosensitive channel protein Piezo1 overexpression in human nucleus pulposus cells, which aggravates mitochondrial damage and inflammatory response in NP cells and further triggers the reduction of autophagy and the intensification of apoptosis. The imbalance between autophagy and apoptosis may result in cell senescence and dysfunction, weaken the synthesis of collagen II and Aggrecan in NP cells, and consequently precipitate cell death and exacerbate disc degeneration

Journal: Arthritis research & therapy

Article Title: Excessive mechanical stress-induced intervertebral disc degeneration is related to Piezo1 overexpression triggering the imbalance of autophagy/apoptosis in human nucleus pulpous.

doi: 10.1186/s13075-022-02804-y

Figure Lengend Snippet: Fig. 5 Excessive mechanical stress stimulates mechanosensitive channel protein Piezo1 overexpression in human nucleus pulposus cells, which aggravates mitochondrial damage and inflammatory response in NP cells and further triggers the reduction of autophagy and the intensification of apoptosis. The imbalance between autophagy and apoptosis may result in cell senescence and dysfunction, weaken the synthesis of collagen II and Aggrecan in NP cells, and consequently precipitate cell death and exacerbate disc degeneration

Article Snippet: The blots were probed overnight with primary antibodies against Piezo1 (Novus Biologicals, USA), collagen II, aggrecan (from Abcam, USA), p53, p16, LC3, Beclin-1, p62, Bax, Bcl-2, and β-actin (from Cell Signaling Technology, USA), followed by incubation with fluorescently-labeled secondary antibody (LI-COR, USA).

Techniques: Over Expression

A Immunofluorescence images of Piezo1 (magenta) and Piezo2 (green) in the femurs of WT mice. Scale bar: 20 µm. The right panels show optical sections from Airyscan superresolution images merged with differential interference contrast (DIC) images in the area indicated by white rectangles. Mature osteoblasts (Ob), osteocytes (Ocy) and osteoclasts (Oc) expressing Piezo1 and Piezo2. Scale bar: 5 µm. B , D Piezo1 (magenta) and Piezo2 (green) immunofluorescence images of trabecular (upper) and cortical (lower) bones in the distal femur from each group. Scale bars: 50 µm. C Piezo1 fluorescence intensity and number of Piezo1-positive surfaces per trabecular bone surface (Piezo1 + . S/BS) were significantly lower than those in the controls. E Piezo2 fluorescence intensity and number of Piezo2-positive surfaces per trabecular bone surface (Piezo2 + S/BS) were significantly lower than those in the controls. F Immunoblot analyses of Piezo1 and Piezo2 expression in the femur. Graphs showing the results of the quantitative analysis of the band intensities. n = 3–4 male mice per group. The data are presented as the median with IQR. One-way ANOVA with Tukey’s post hoc test was used. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control groups.

Journal: Communications Biology

Article Title: Ovalbumin-induced asthma leads to bone loss with Piezo channel suppression in mice

doi: 10.1038/s42003-025-08753-x

Figure Lengend Snippet: A Immunofluorescence images of Piezo1 (magenta) and Piezo2 (green) in the femurs of WT mice. Scale bar: 20 µm. The right panels show optical sections from Airyscan superresolution images merged with differential interference contrast (DIC) images in the area indicated by white rectangles. Mature osteoblasts (Ob), osteocytes (Ocy) and osteoclasts (Oc) expressing Piezo1 and Piezo2. Scale bar: 5 µm. B , D Piezo1 (magenta) and Piezo2 (green) immunofluorescence images of trabecular (upper) and cortical (lower) bones in the distal femur from each group. Scale bars: 50 µm. C Piezo1 fluorescence intensity and number of Piezo1-positive surfaces per trabecular bone surface (Piezo1 + . S/BS) were significantly lower than those in the controls. E Piezo2 fluorescence intensity and number of Piezo2-positive surfaces per trabecular bone surface (Piezo2 + S/BS) were significantly lower than those in the controls. F Immunoblot analyses of Piezo1 and Piezo2 expression in the femur. Graphs showing the results of the quantitative analysis of the band intensities. n = 3–4 male mice per group. The data are presented as the median with IQR. One-way ANOVA with Tukey’s post hoc test was used. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control groups.

Article Snippet: The primary antibodies used were as follows: Piezo1 (1 μg/ml), Piezo2 (1 μg/ml), Osterix (1:4000, ab22552, Abcam), type I collagen (1 μg/ml) , podoplanin (1:1000, AF3244, R&D Systems), semaphorin 3 A (1 μg/ml, ab23393, Abcam), Piezo1 (1:400, 15939-1, Proteintech), Piezo1 (1:400, NBP1-78446SS, Novus), KDEL (1:200, M181-3, MBL), GM130 (1:200, BD 610822, BD Pharmingen), calnexin (1:3000, ab22595, Abcam), CD63 (1:600, BD 564221, BD Pharmingen), Lamp-1 (1:200, BD 553792, BD Pharmingen) and EEA1 (1:200, M176-3, MBL).

Techniques: Immunofluorescence, Expressing, Fluorescence, Western Blot, Control

A Airyscan superresolution images of mature osteoblasts on the bone surface of distal femoral metaphysis from WT mice. Piezo1 (green) colocalized with calnexin (magenta), and Piezo2 (green) colocalized with GM130 (magenta) was observed. Scale bar: 5 µm. B Immunoelectron microscopy images of osteoblasts in the femur. Elevated electron densities with diaminobenzidine (DAB)-positive immunoreactivities were detected in rough endoplasmic reticulum (rER) membranes with the Piezo1 antibody and in Golgi membranes with the Piezo2 antibody. Note the lack of DAB reaction products in the Golgi and nuclear membranes in the former and that in rER and nuclear membranes in the latter, respectively. N: nucleus, m: mitochondria, G: Golgi stacks. Scale bar: 1 µm. C Airyscan superresolution images of optical sections obtained at z-intervals of 160 nm and processed by Airyscan Joint Deconvolution. Osteoblasts were stained with Piezo2 (green) and Col1 (magenta) in the femurs of the PBS group. Scale bar: 5 µm. The lower panels show higher-magnification images of the yellow rectangles. Scale bar: 1 µm. Line plots along white arrowheads show the localization of Piezo2 and Col1 puncta in the Golgi area (i) and osteoid (ii). A.U.: arbitrary units. D Representative immunofluorescence images of calnexin and GM130 in the groups. Scale bars: 50 µm, 10 µm. E Fluorescence intensity of calnexin and GM130 in the trabecular region of the femur. F Airyscan superresolution images of osteoblasts immunostained with Piezo1 (green) and calnexin (magenta) (upper panels), and Piezo2 (green) and GM130 (magenta) (lower panels), showing less immunolabelling in the O + A group than in the control group. Scale bar: 5 µm. G Quantitative analysis of the weighted colocalization (as a percentage) of calnexin with Piezo1 and GM130 with Piezo2 in femur osteoblasts. H Airyscan superresolution images of Col1 (green) and GM130 (magenta) immunofluorescence in osteoblasts from the femur. Scale bar: 5 µm. I Quantitative analysis of Col1 fluorescence intensity and weighted colocalization (as a percentage) of Col1 with GM130 in femur osteoblasts. n = 3 male mice per group. The data are presented as the median with IQR. One-way ANOVA with Tukey’s post hoc test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control groups.

Journal: Communications Biology

Article Title: Ovalbumin-induced asthma leads to bone loss with Piezo channel suppression in mice

doi: 10.1038/s42003-025-08753-x

Figure Lengend Snippet: A Airyscan superresolution images of mature osteoblasts on the bone surface of distal femoral metaphysis from WT mice. Piezo1 (green) colocalized with calnexin (magenta), and Piezo2 (green) colocalized with GM130 (magenta) was observed. Scale bar: 5 µm. B Immunoelectron microscopy images of osteoblasts in the femur. Elevated electron densities with diaminobenzidine (DAB)-positive immunoreactivities were detected in rough endoplasmic reticulum (rER) membranes with the Piezo1 antibody and in Golgi membranes with the Piezo2 antibody. Note the lack of DAB reaction products in the Golgi and nuclear membranes in the former and that in rER and nuclear membranes in the latter, respectively. N: nucleus, m: mitochondria, G: Golgi stacks. Scale bar: 1 µm. C Airyscan superresolution images of optical sections obtained at z-intervals of 160 nm and processed by Airyscan Joint Deconvolution. Osteoblasts were stained with Piezo2 (green) and Col1 (magenta) in the femurs of the PBS group. Scale bar: 5 µm. The lower panels show higher-magnification images of the yellow rectangles. Scale bar: 1 µm. Line plots along white arrowheads show the localization of Piezo2 and Col1 puncta in the Golgi area (i) and osteoid (ii). A.U.: arbitrary units. D Representative immunofluorescence images of calnexin and GM130 in the groups. Scale bars: 50 µm, 10 µm. E Fluorescence intensity of calnexin and GM130 in the trabecular region of the femur. F Airyscan superresolution images of osteoblasts immunostained with Piezo1 (green) and calnexin (magenta) (upper panels), and Piezo2 (green) and GM130 (magenta) (lower panels), showing less immunolabelling in the O + A group than in the control group. Scale bar: 5 µm. G Quantitative analysis of the weighted colocalization (as a percentage) of calnexin with Piezo1 and GM130 with Piezo2 in femur osteoblasts. H Airyscan superresolution images of Col1 (green) and GM130 (magenta) immunofluorescence in osteoblasts from the femur. Scale bar: 5 µm. I Quantitative analysis of Col1 fluorescence intensity and weighted colocalization (as a percentage) of Col1 with GM130 in femur osteoblasts. n = 3 male mice per group. The data are presented as the median with IQR. One-way ANOVA with Tukey’s post hoc test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control groups.

Article Snippet: The primary antibodies used were as follows: Piezo1 (1 μg/ml), Piezo2 (1 μg/ml), Osterix (1:4000, ab22552, Abcam), type I collagen (1 μg/ml) , podoplanin (1:1000, AF3244, R&D Systems), semaphorin 3 A (1 μg/ml, ab23393, Abcam), Piezo1 (1:400, 15939-1, Proteintech), Piezo1 (1:400, NBP1-78446SS, Novus), KDEL (1:200, M181-3, MBL), GM130 (1:200, BD 610822, BD Pharmingen), calnexin (1:3000, ab22595, Abcam), CD63 (1:600, BD 564221, BD Pharmingen), Lamp-1 (1:200, BD 553792, BD Pharmingen) and EEA1 (1:200, M176-3, MBL).

Techniques: Immuno-Electron Microscopy, Staining, Immunofluorescence, Fluorescence, Control